AT3G51690

Belongs to the helicase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0001547
Physical Location & Seq
Reverse (-)
19176328 .. 19178161
1834 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G51690.1

Sequence Viewer

Length: 996 bp
ATGGCTCTAATTCGTAATCACCCTTCTGCTTCTCTCGGTGAGATCAGACCATGGAAGATCAAAGTGCAGATAGTTAGAACGTCGAAGGGAAATAAGAAAGAATCAGACAACTCCATCGACTTGGTTTTACTCGATTCGTCGGAGACAAGAATTCACACAACTATAGATGAAGCTCTTTCTAGATGGATTATGAACATTAGTGGTGATAATATCAACAATCCAAATGATGGAGAAACTGAAATTGATATTTCCAAAGATTTGTTGATAACTGAATCCAAAGATCCTATCAAAACTTTACTGAAAGAAGTTTATGGAGAATATTTTGCAAAGTCCTACAATCCTGATTTTTGTCACGACAGTGCTATTTTGTGTCATCGTGATGACGATGTGGATCAGATTAATGATTATATGCTTTCACTATTACCAGGTGAAGAGAAAGAATGTCTCAGCACTGACAGTATTTCTCCAAGCCCAAATGACGACATGTTTGTCCCTCTAGAGGTTTTGAATAGCATCAAAGTCCCCGGATTGCCTGATTTTAAGCTGAGGTTAAAGGTTGGTGCTCCTGTCATGTTACTTAGGGACCTTGATCCTAGCCGTGGTTTTTTTACGGGGACAAGACTTCAAATTACTCGGCTGTGTGGGTTTTTGCTTGAGGCTATGATTATAGCAGGTAATAAGCATGGTAAGAAAATCTGGATCCCTAGGATAGCTTCATACCCCACAGAAACAAATTTTCCTCTTCAAATGCGGCGTACGCAATATCCTTTGAAACTTGCGTTCGCGATGACTATAGATGAAAGTCAAGTGCATACACTTTCCAAAGTTGGTCTATATCTACCAAGACAAGTGTTCTCTCATGGACGACAGATGTTTGTTGCTATATCCAAGGTGAAGTCAAGAGCTGGTTTGAAAGTTCTTATAACAGACAAAGATGGGAACCCTCAGGAAGAAGCCAAGAATGTTGTGTTCAAGGAGTTGTTTCAAAACATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Herpes_Helicase PIF1

Protein Analysis

331

Amino Acids

37.42

Weight (kDa)

6.41

Isoelectric Point (pI)

37.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pif1_2B_dom PF21530 167 - 213 2.1e-16 DNA helicase Pif1, 2B domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 923
AasI GACNNNNNNGTC 1 cut(s) 488
Acc36I ACCTGC 1 cut(s) 662
AccB7I CCANNNNNTGG 1 cut(s) 227
AccII CGCG 1 cut(s) 785
AciI CCGC 1 cut(s) 751
AclWI GGATC 5 cut(s) 275, 399, 584, 694, 707
AcsI RAATTY 2 cut(s) 150, 733
AfaI GTAC 1 cut(s) 757
AfiI CCNNNNNNNGG 3 cut(s) 227, 499, 599
AflIII ACRYGT 1 cut(s) 483
AgsI TTSAA 7 cut(s) 508, 626, 746, 772, 913, 973, 986
AjnI CCWGG 1 cut(s) 424
AleI CACNNNNGTG 1 cut(s) 357
AluBI AGCT 4 cut(s) 173, 544, 713, 905
AluI AGCT 4 cut(s) 173, 544, 713, 905
Alw21I GWGCWC 1 cut(s) 565
Alw26I GTCTC 2 cut(s) 137, 449
AlwI GGATC 5 cut(s) 275, 399, 584, 694, 707
ApoI RAATTY 2 cut(s) 150, 733
ArsI GACNNNNNNTTYG 2 cut(s) 470, 502
AseI ATTAAT 1 cut(s) 399
AspA2I CCTAGG 1 cut(s) 704
AspS9I GGNCC 1 cut(s) 583
AsuC2I CCSGG 1 cut(s) 525
AsuHPI GGTGA 5 cut(s) 11, 50, 215, 440, 904
AvaII GGWCC 1 cut(s) 583
AvrII CCTAGG 1 cut(s) 704
AxyI CCTNAGG 1 cut(s) 945
BamHI GGATCC 1 cut(s) 699
BarI GAAGNNNNNNTAC 2 cut(s) 7, 39
Bbv12I GWGCWC 1 cut(s) 565
BbvCI CCTCAGC 1 cut(s) 545
BccI CCATC 4 cut(s) 122, 177, 221, 929
BceAI ACGGC 1 cut(s) 582
BciT130I CCWGG 1 cut(s) 426
BcnI CCSGG 1 cut(s) 525
BcoDI GTCTC 2 cut(s) 137, 449
BfaI CTAG 4 cut(s) 180, 497, 594, 705
BfmI CTRYAG 2 cut(s) 162, 792
BfuAI ACCTGC 1 cut(s) 662
BisI GCNGC 1 cut(s) 752
BlnI CCTAGG 1 cut(s) 704
BlsI GCNGC 1 cut(s) 753
Bme1390I CCNGG 2 cut(s) 426, 525
Bme18I GGWCC 1 cut(s) 583
BmgT120I GGNCC 1 cut(s) 583
BmiI GGNNCC 3 cut(s) 584, 701, 941
BmrFI CCNGG 2 cut(s) 426, 525
BmsI GCATC 1 cut(s) 522
Bpu10I CCTNAGC 1 cut(s) 545
BpuEI CTTGAG 1 cut(s) 674
BpuMI CCSGG 1 cut(s) 525
BsaBI GATNNNNATC 1 cut(s) 390
BsaJI CCNNGG 5 cut(s) 50, 523, 598, 704, 888
Bsc4I CCNNNNNNNGG 3 cut(s) 227, 499, 599
Bse21I CCTNAGG 1 cut(s) 945
Bse8I GATNNNNATC 1 cut(s) 390
BseBI CCWGG 1 cut(s) 426
BseDI CCNNGG 5 cut(s) 50, 523, 598, 704, 888
BseJI GATNNNNATC 1 cut(s) 390
BseLI CCNNNNNNNGG 3 cut(s) 227, 499, 599
BseMII CTCAG 3 cut(s) 460, 536, 959
BsgI GTGCAG 1 cut(s) 86
Bsh1236I CGCG 1 cut(s) 785
BsiHKAI GWGCWC 1 cut(s) 565
BsiSI CCGG 1 cut(s) 525
BsiWI CGTACG 1 cut(s) 755
BslFI GGGAC 4 cut(s) 476, 506, 596, 628
BslI CCNNNNNNNGG 3 cut(s) 227, 499, 599
BsmAI GTCTC 2 cut(s) 137, 449
BsmFI GGGAC 4 cut(s) 476, 506, 596, 628
Bsp1286I GDGCHC 1 cut(s) 565
Bsp143I GATC 6 cut(s) 42, 57, 280, 391, 589, 699
Bsp19I CCATGG 1 cut(s) 50
Bsp68I TCGCGA 1 cut(s) 785
BspACI CCGC 1 cut(s) 751
BspCNI CTCAG 3 cut(s) 459, 537, 958
BspFNI CGCG 1 cut(s) 785
BspLI GGNNCC 3 cut(s) 584, 701, 941
BspMI ACCTGC 1 cut(s) 662
BspPI GGATC 5 cut(s) 275, 399, 584, 694, 707
BssECI CCNNGG 5 cut(s) 50, 523, 598, 704, 888
BssMI GATC 6 cut(s) 42, 57, 280, 391, 589, 699
BssT1I CCWWGG 3 cut(s) 50, 704, 888
Bst2UI CCWGG 1 cut(s) 426
Bst4CI ACNGT 2 cut(s) 359, 458
Bst6I CTCTTC 2 cut(s) 426, 747
BstDEI CTNAG 4 cut(s) 446, 545, 578, 945
BstDSI CCRYGG 2 cut(s) 50, 598
BstFNI CGCG 1 cut(s) 785
BstKTI GATC 6 cut(s) 45, 60, 283, 394, 592, 702
BstMAI GTCTC 2 cut(s) 137, 449
BstMBI GATC 6 cut(s) 42, 57, 280, 391, 589, 699
BstMWI GCNNNNNNNGC 1 cut(s) 757
BstNI CCWGG 1 cut(s) 426
BstNSI RCATGY 1 cut(s) 487
BstSCI CCNGG 2 cut(s) 424, 523
BstSFI CTRYAG 2 cut(s) 162, 792
BstUI CGCG 1 cut(s) 785
BstX2I RGATCY 2 cut(s) 280, 699
BstXI CCANNNNNNTGG 1 cut(s) 121
BstYI RGATCY 2 cut(s) 280, 699
Bsu36I CCTNAGG 1 cut(s) 945
BtgI CCRYGG 2 cut(s) 50, 598
BtgZI GCGATG 1 cut(s) 800
BtsIMutI CAGTG 2 cut(s) 364, 450
BtuMI TCGCGA 1 cut(s) 785
BveI ACCTGC 1 cut(s) 662
Cfr13I GGNCC 1 cut(s) 583
CsiI ACCWGGT 1 cut(s) 424
Csp6I GTAC 1 cut(s) 756
CviAII CATG 5 cut(s) 51, 484, 571, 683, 860
CviQI GTAC 1 cut(s) 756
DdeI CTNAG 4 cut(s) 446, 545, 578, 945
DpnI GATC 6 cut(s) 44, 59, 282, 393, 591, 701
DpnII GATC 6 cut(s) 42, 57, 280, 391, 589, 699
DrdI GACNNNNNNGTC 1 cut(s) 488
DseDI GACNNNNNNGTC 1 cut(s) 488
Eam1104I CTCTTC 2 cut(s) 426, 747
EarI CTCTTC 2 cut(s) 426, 747
Eco130I CCWWGG 3 cut(s) 50, 704, 888
Eco47I GGWCC 1 cut(s) 583
Eco81I CCTNAGG 1 cut(s) 945
EcoO109I RGGNCCY 1 cut(s) 583
EcoRI GAATTC 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 424
EcoT14I CCWWGG 3 cut(s) 50, 704, 888
ErhI CCWWGG 3 cut(s) 50, 704, 888
FaeI CATG 5 cut(s) 54, 487, 574, 686, 863
FaqI GGGAC 4 cut(s) 476, 506, 596, 628
FatI CATG 5 cut(s) 50, 483, 570, 682, 859
Fnu4HI GCNGC 1 cut(s) 752
Fsp4HI GCNGC 1 cut(s) 752
FspBI CTAG 4 cut(s) 180, 497, 594, 705
GluI GCNGC 1 cut(s) 752
HapII CCGG 1 cut(s) 525
Hin1II CATG 5 cut(s) 54, 487, 574, 686, 863
HinfI GANTC 3 cut(s) 101, 134, 272
HpaII CCGG 1 cut(s) 525
HphI GGTGA 5 cut(s) 11, 50, 215, 440, 904
Hpy188I TCNGA 4 cut(s) 47, 106, 142, 396
Hpy188III TCNNGA 9 cut(s) 180, 341, 353, 377, 497, 697, 784, 900, 947
Hpy99I CGWCG 2 cut(s) 85, 142
HpyAV CCTTC 2 cut(s) 33, 79
HpyCH4III ACNGT 2 cut(s) 359, 458
HpyCH4IV ACGT 1 cut(s) 80
HpyCH4V TGCA 3 cut(s) 67, 326, 811
HpyF10VI GCNNNNNNNGC 1 cut(s) 757
HpyF3I CTNAG 4 cut(s) 446, 545, 578, 945
HpySE526I ACGT 1 cut(s) 80
Hsp92II CATG 5 cut(s) 54, 487, 574, 686, 863
Kzo9I GATC 6 cut(s) 42, 57, 280, 391, 589, 699
LmnI GCTCC 1 cut(s) 568
LweI GCATC 1 cut(s) 522
MabI ACCWGGT 1 cut(s) 424
MaeI CTAG 4 cut(s) 180, 497, 594, 705
MaeII ACGT 1 cut(s) 80
MaeIII GTNAC 2 cut(s) 350, 573
MalI GATC 6 cut(s) 44, 59, 282, 393, 591, 701
MboI GATC 6 cut(s) 42, 57, 280, 391, 589, 699
MboII GAAGA 4 cut(s) 67, 443, 734, 962
MflI RGATCY 2 cut(s) 280, 699
MhlI GDGCHC 1 cut(s) 565
MluCI AATT 5 cut(s) 9, 150, 240, 627, 733
MmeI TCCRAC 1 cut(s) 120
MnlI CCTC 6 cut(s) 493, 504, 540, 649, 750, 954
MseI TTAA 3 cut(s) 399, 540, 551
MslI CAYNNNNRTG 2 cut(s) 357, 378
MspI CCGG 1 cut(s) 525
MspR9I CCNGG 2 cut(s) 426, 525
MvaI CCWGG 1 cut(s) 426
MvnI CGCG 1 cut(s) 785
MwoI GCNNNNNNNGC 1 cut(s) 757
NciI CCSGG 1 cut(s) 525
NcoI CCATGG 1 cut(s) 50
NdeII GATC 6 cut(s) 42, 57, 280, 391, 589, 699
NlaIII CATG 5 cut(s) 54, 487, 574, 686, 863
NlaIV GGNNCC 3 cut(s) 584, 701, 941
NmeAIII GCCGAG 1 cut(s) 613
NmuCI GTSAC 1 cut(s) 350
NruI TCGCGA 1 cut(s) 785
NspI RCATGY 1 cut(s) 487
OliI CACNNNNGTG 1 cut(s) 357
PciI ACATGT 1 cut(s) 483
PfeI GAWTC 3 cut(s) 101, 134, 272
Pfl23II CGTACG 1 cut(s) 755
PflMI CCANNNNNTGG 1 cut(s) 227
PkrI GCNGC 1 cut(s) 753
PpuMI RGGWCCY 1 cut(s) 583
PscI ACATGT 1 cut(s) 483
PshBI ATTAAT 1 cut(s) 399
PsiI TTATAA 1 cut(s) 923
Psp5II RGGWCCY 1 cut(s) 583
Psp6I CCWGG 1 cut(s) 424
PspGI CCWGG 1 cut(s) 424
PspLI CGTACG 1 cut(s) 755
PspN4I GGNNCC 3 cut(s) 584, 701, 941
PspPI GGNCC 1 cut(s) 583
PspPPI RGGWCCY 1 cut(s) 583
PsuI RGATCY 2 cut(s) 280, 699
RruI TCGCGA 1 cut(s) 785
RsaI GTAC 1 cut(s) 757
RsaNI GTAC 1 cut(s) 756
RseI CAYNNNNRTG 2 cut(s) 357, 378
SaqAI TTAA 3 cut(s) 399, 540, 551
SatI GCNGC 1 cut(s) 752
Sau3AI GATC 6 cut(s) 42, 57, 280, 391, 589, 699
Sau96I GGNCC 1 cut(s) 583
ScrFI CCNGG 2 cut(s) 426, 525
SduI GDGCHC 1 cut(s) 565
SexAI ACCWGGT 1 cut(s) 424
SfaNI GCATC 1 cut(s) 522
SfcI CTRYAG 2 cut(s) 162, 792
SinI GGWCC 1 cut(s) 583
SmiMI CAYNNNNRTG 2 cut(s) 357, 378
SmlI CTYRAG 1 cut(s) 653
SmoI CTYRAG 1 cut(s) 653
Sse9I AATT 5 cut(s) 9, 150, 240, 627, 733
SsiI CCGC 1 cut(s) 751
SspI AATATT 1 cut(s) 320
SspMI CTAG 4 cut(s) 180, 497, 594, 705
StyD4I CCNGG 2 cut(s) 424, 523
StyI CCWWGG 3 cut(s) 50, 704, 888
TaaI ACNGT 2 cut(s) 359, 458
TaiI ACGT 1 cut(s) 83
TaqI TCGA 3 cut(s) 83, 117, 132
TasI AATT 5 cut(s) 9, 150, 240, 627, 733
TauI GCSGC 1 cut(s) 754
TfiI GAWTC 3 cut(s) 101, 134, 272
Tru1I TTAA 3 cut(s) 399, 540, 551
Tru9I TTAA 3 cut(s) 399, 540, 551
TscAI CASTG 2 cut(s) 364, 457
TseFI GTSAC 1 cut(s) 350
Tsp45I GTSAC 1 cut(s) 350
TspDTI ATGAA 4 cut(s) 183, 206, 705, 813
TspRI CASTG 2 cut(s) 364, 457
Van91I CCANNNNNTGG 1 cut(s) 227
VpaK11BI GGWCC 1 cut(s) 583
VspI ATTAAT 1 cut(s) 399
XapI RAATTY 2 cut(s) 150, 733
XbaI TCTAGA 2 cut(s) 179, 496
XceI RCATGY 1 cut(s) 487
XmaJI CCTAGG 1 cut(s) 704
XspI CTAG 4 cut(s) 180, 497, 594, 705
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.