Rmu_sc0002236.1_g000014

G-quadruplex DNA unwinding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002236.1
Physical Location & Seq
Forward (+)
46564 .. 51333
4770 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002236.1_g000014.1.cds

Sequence Viewer

Length: 1329 bp
atgggtaattggattgcccgacgtggagagaaagagaagtgcgccgatcaagtcttccacaagcggaaggagtttctagatctgaggaacagtgtgctgtcaacttctttagctctttcggcttcagatataaatatttcagaaatggcggttcgacatggaagaaataaacaatatattgttttgggtgaaaagagaagtgaagatgaactctgcgtttcacaaagtagtcgagagaatttctcgaatatgaggagaaaaagacaaaagcaaagagctggtgattccactatggtcgagcattcaatttcatctactgttgttggtgttacagacgctgtacctgataccgctgctatgccatcatgtccaagagcacgaaaaatgcgtgtcgattctcaaaaaactgtttcaactgtagcaaccattggtcaagcatcatatcaaagaagtaggagtggaatttgtccaagttatgcagattttggagataaaattttcgaatgtcgttattgcaacgcattattttggttaaatgaatctacaaaagtgacgcatcaaaatcaatctccgactttcacattatgttgtcagcatggcagagtaacacttccatcagcacgtccaacaccaaaatttcttgatgaattattagacccaacaaaaggacatagaagtttactgttcagacaaaatattcggatttacaattccatgttttgttttacttcaatgggagcaaaaattgaacgcactattaatgatggttccggtccttatgtttttaaaattagtggtcaagttcatcacttaatgggatctttgttacctcccgaaaatgaatctccaaaatatgcgcaactatatgtatatgatactcaacatgaggtaacaaatcggatcagagctattgacagtgatgaatcaaatgataagcttgatccaagtattgttcatcaattgatcacaatgtttgacgatgtgaatgaattggttaaactttttcgaaccaaaagaaatgaatttgaaaatgcttctttgccgacatttcgtatgactatgctcgatcggcaattaactgacagcagacaatatgaacagcctgcatgtaatgaaattagtggtttgatcgttggtgatataggcctttctaattcaaatagagatattgtagtccaattaaaagatgaacgcttacaacgtgtctcaaagttacattcaaaatatatgtcactacaatatccaatcctttttccatatggcgaagatggttatagtccagatttaaaaatgcaagcccctgaaggacgcagtcagcaaaatacgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

442

Amino Acids

50.31

Weight (kDa)

8.79

Isoelectric Point (pI)

50.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 858
AciI CCGC 3 cut(s) 64, 149, 351
AclWI GGATC 3 cut(s) 826, 908, 935
AcsI RAATTY 5 cut(s) 238, 462, 495, 635, 1022
AcuI CTGAAG 2 cut(s) 108, 1323
AfaI GTAC 1 cut(s) 342
AfiI CCNNNNNNNGG 1 cut(s) 665
AflIII ACRYGT 1 cut(s) 1201
AgsI TTSAA 7 cut(s) 306, 414, 732, 749, 1028, 1158, 1221
AjiI CACGTC 2 cut(s) 23, 623
AluBI AGCT 4 cut(s) 113, 278, 908, 937
AluI AGCT 4 cut(s) 113, 278, 908, 937
Alw21I GWGCWC 1 cut(s) 379
Alw26I GTCTC 1 cut(s) 1210
AlwI GGATC 3 cut(s) 826, 908, 935
AlwNI CAGNNNCTG 1 cut(s) 338
AoxI GGCC 1 cut(s) 1144
ApeKI GCWGC 1 cut(s) 353
ApoI RAATTY 5 cut(s) 238, 462, 495, 635, 1022
ArsI GACNNNNNNTTYG 4 cut(s) 681, 713, 1214, 1246
AseI ATTAAT 1 cut(s) 759
AspLEI GCGC 2 cut(s) 44, 859
AspS9I GGNCC 1 cut(s) 773
AsuHPI GGTGA 3 cut(s) 200, 293, 1148
AsuII TTCGAA 2 cut(s) 501, 1006
AvaII GGWCC 1 cut(s) 773
BbsI GAAGAC 1 cut(s) 46
Bbv12I GWGCWC 1 cut(s) 379
BbvI GCAGC 1 cut(s) 340
BccI CCATC 4 cut(s) 370, 622, 758, 1262
BclI TGATCA 1 cut(s) 963
BcoDI GTCTC 1 cut(s) 1210
BfaI CTAG 1 cut(s) 77
BfmI CTRYAG 1 cut(s) 417
BglII AGATCT 1 cut(s) 79
BisI GCNGC 1 cut(s) 354
BlsI GCNGC 1 cut(s) 355
Bme18I GGWCC 1 cut(s) 773
BmgBI CACGTC 2 cut(s) 23, 623
BmgT120I GGNCC 1 cut(s) 773
BmiI GGNNCC 1 cut(s) 769
BmsI GCATC 2 cut(s) 446, 565
BpiI GAAGAC 1 cut(s) 46
BplI GAGNNNNNCTC 2 cut(s) 227, 259
Bpu14I TTCGAA 2 cut(s) 501, 1006
BsaAI YACGTR 1 cut(s) 1326
BsaWI WCCGGW 1 cut(s) 770
Bsc4I CCNNNNNNNGG 1 cut(s) 665
BseLI CCNNNNNNNGG 1 cut(s) 665
BseMII CTCAG 1 cut(s) 74
BseRI GAGGAG 1 cut(s) 268
BseXI GCAGC 1 cut(s) 340
Bsh1285I CGRYCG 1 cut(s) 1069
BshFI GGCC 1 cut(s) 1146
BsiEI CGRYCG 1 cut(s) 1069
BsiHKAI GWGCWC 1 cut(s) 379
BsiSI CCGG 1 cut(s) 771
BslI CCNNNNNNNGG 1 cut(s) 665
BsmAI GTCTC 1 cut(s) 1210
BsmI GAATGC 1 cut(s) 301
BsnI GGCC 1 cut(s) 1146
Bsp119I TTCGAA 2 cut(s) 501, 1006
Bsp1286I GDGCHC 1 cut(s) 379
Bsp143I GATC 8 cut(s) 46, 79, 818, 900, 940, 963, 1066, 1128
BspACI CCGC 3 cut(s) 64, 149, 351
BspANI GGCC 1 cut(s) 1146
BspCNI CTCAG 1 cut(s) 75
BspLI GGNNCC 1 cut(s) 769
BspPI GGATC 3 cut(s) 826, 908, 935
BspT104I TTCGAA 2 cut(s) 501, 1006
BssMI GATC 8 cut(s) 46, 79, 818, 900, 940, 963, 1066, 1128
Bst4CI ACNGT 6 cut(s) 92, 319, 409, 418, 684, 917
BstBAI YACGTR 1 cut(s) 1326
BstBI TTCGAA 2 cut(s) 501, 1006
BstC8I GCNNGC 2 cut(s) 1104, 1296
BstDEI CTNAG 1 cut(s) 83
BstHHI GCGC 2 cut(s) 44, 859
BstKTI GATC 8 cut(s) 49, 82, 821, 903, 943, 966, 1069, 1131
BstMAI GTCTC 1 cut(s) 1210
BstMBI GATC 8 cut(s) 46, 79, 818, 900, 940, 963, 1066, 1128
BstMCI CGRYCG 1 cut(s) 1069
BstMWI GCNNNNNNNGC 2 cut(s) 119, 1069
BstNSI RCATGY 1 cut(s) 1110
BstSFI CTRYAG 1 cut(s) 417
BstV1I GCAGC 1 cut(s) 340
BstV2I GAAGAC 1 cut(s) 46
BstX2I RGATCY 2 cut(s) 79, 818
BstYI RGATCY 2 cut(s) 79, 818
BsuRI GGCC 1 cut(s) 1146
BtrI CACGTC 2 cut(s) 23, 623
BtsIMutI CAGTG 2 cut(s) 97, 922
Cac8I GCNNGC 2 cut(s) 1104, 1296
CaiI CAGNNNCTG 1 cut(s) 338
CfoI GCGC 2 cut(s) 44, 859
Cfr13I GGNCC 1 cut(s) 773
CseI GACGC 3 cut(s) 344, 562, 1317
Csp6I GTAC 1 cut(s) 341
CviAII CATG 6 cut(s) 158, 366, 596, 715, 884, 1107
CviJI RGCY 8 cut(s) 113, 122, 278, 908, 937, 1102, 1146, 1298
CviKI_1 RGCY 8 cut(s) 113, 122, 278, 908, 937, 1102, 1146, 1298
CviQI GTAC 1 cut(s) 341
DdeI CTNAG 1 cut(s) 83
DpnI GATC 8 cut(s) 48, 81, 820, 902, 942, 965, 1068, 1130
DpnII GATC 8 cut(s) 46, 79, 818, 900, 940, 963, 1066, 1128
DraI TTTAAA 2 cut(s) 787, 1287
Eco147I AGGCCT 1 cut(s) 1146
Eco47I GGWCC 1 cut(s) 773
Eco57I CTGAAG 2 cut(s) 108, 1323
FaeI CATG 6 cut(s) 161, 369, 599, 718, 887, 1110
FatI CATG 6 cut(s) 157, 365, 595, 714, 883, 1106
FauNDI CATATG 1 cut(s) 1258
FbaI TGATCA 1 cut(s) 963
Fnu4HI GCNGC 1 cut(s) 354
Fsp4HI GCNGC 1 cut(s) 354
FspBI CTAG 1 cut(s) 77
FspI TGCGCA 1 cut(s) 858
GlaI GCGC 2 cut(s) 43, 858
GluI GCNGC 1 cut(s) 354
HaeIII GGCC 1 cut(s) 1146
HapII CCGG 1 cut(s) 771
HgaI GACGC 3 cut(s) 344, 562, 1317
HhaI GCGC 2 cut(s) 44, 859
Hin1II CATG 6 cut(s) 161, 369, 599, 718, 887, 1110
Hin6I GCGC 2 cut(s) 42, 857
HinP1I GCGC 2 cut(s) 42, 857
HincII GTYRAC 1 cut(s) 102
HindII GTYRAC 1 cut(s) 102
HindIII AAGCTT 1 cut(s) 935
HinfI GANTC 5 cut(s) 284, 395, 539, 842, 923
HpaII CCGG 1 cut(s) 771
HphI GGTGA 3 cut(s) 200, 293, 1148
Hpy166II GTNNAC 2 cut(s) 102, 680
Hpy188I TCNGA 8 cut(s) 84, 127, 142, 573, 689, 702, 900, 905
Hpy188III TCNNGA 6 cut(s) 77, 233, 244, 641, 833, 1280
Hpy8I GTNNAC 2 cut(s) 102, 680
Hpy99I CGWCG 1 cut(s) 24
HpyAV CCTTC 2 cut(s) 61, 1298
HpyCH4III ACNGT 6 cut(s) 92, 319, 409, 418, 684, 917
HpyCH4IV ACGT 4 cut(s) 22, 622, 1201, 1325
HpyCH4V TGCA 4 cut(s) 479, 516, 1106, 1294
HpyF10VI GCNNNNNNNGC 2 cut(s) 119, 1069
HpyF3I CTNAG 1 cut(s) 83
HpySE526I ACGT 4 cut(s) 22, 622, 1201, 1325
Hsp92II CATG 6 cut(s) 161, 369, 599, 718, 887, 1110
HspAI GCGC 2 cut(s) 42, 857
Ksp22I TGATCA 1 cut(s) 963
Kzo9I GATC 8 cut(s) 46, 79, 818, 900, 940, 963, 1066, 1128
LmnI GCTCC 1 cut(s) 737
LpnPI CCDG 6 cut(s) 264, 357, 784, 1116, 1293, 1314
Lsp1109I GCAGC 1 cut(s) 340
LweI GCATC 2 cut(s) 446, 565
MaeI CTAG 1 cut(s) 77
MaeII ACGT 4 cut(s) 22, 622, 1201, 1325
MaeIII GTNAC 7 cut(s) 328, 550, 604, 825, 889, 1212, 1230
MalI GATC 8 cut(s) 48, 81, 820, 902, 942, 965, 1068, 1130
MboI GATC 8 cut(s) 46, 79, 818, 900, 940, 963, 1066, 1128
MboII GAAGA 4 cut(s) 46, 174, 215, 1277
MfeI CAATTG 1 cut(s) 959
MflI RGATCY 2 cut(s) 79, 818
MhlI GDGCHC 1 cut(s) 379
MmeI TCCRAC 2 cut(s) 596, 650
MnlI CCTC 4 cut(s) 78, 246, 840, 880
MseI TTAA 8 cut(s) 533, 759, 786, 812, 996, 1076, 1181, 1286
MspA1I CMGCKG 1 cut(s) 353
MspI CCGG 1 cut(s) 771
MunI CAATTG 1 cut(s) 959
Mva1269I GAATGC 1 cut(s) 301
MwoI GCNNNNNNNGC 2 cut(s) 119, 1069
NdeI CATATG 1 cut(s) 1258
NdeII GATC 8 cut(s) 46, 79, 818, 900, 940, 963, 1066, 1128
NlaIII CATG 6 cut(s) 161, 369, 599, 718, 887, 1110
NlaIV GGNNCC 1 cut(s) 769
NmuCI GTSAC 2 cut(s) 550, 1230
NsbI TGCGCA 1 cut(s) 858
NspI RCATGY 1 cut(s) 1110
NspV TTCGAA 2 cut(s) 501, 1006
PceI AGGCCT 1 cut(s) 1146
PcsI WCGNNNNNNNCGW 2 cut(s) 385, 1198
PctI GAATGC 1 cut(s) 301
PfeI GAWTC 5 cut(s) 284, 395, 539, 842, 923
PflFI GACNNNGTC 1 cut(s) 1311
PkrI GCNGC 1 cut(s) 355
Ple19I CGATCG 1 cut(s) 1069
Ppu21I YACGTR 1 cut(s) 1326
PshBI ATTAAT 1 cut(s) 759
PspN4I GGNNCC 1 cut(s) 769
PspPI GGNCC 1 cut(s) 773
PstNI CAGNNNCTG 1 cut(s) 338
PsuI RGATCY 2 cut(s) 79, 818
PsyI GACNNNGTC 1 cut(s) 1311
PvuI CGATCG 1 cut(s) 1069
RsaI GTAC 1 cut(s) 342
RsaNI GTAC 1 cut(s) 341
SaqAI TTAA 8 cut(s) 533, 759, 786, 812, 996, 1076, 1181, 1286
SatI GCNGC 1 cut(s) 354
Sau3AI GATC 8 cut(s) 46, 79, 818, 900, 940, 963, 1066, 1128
Sau96I GGNCC 1 cut(s) 773
SduI GDGCHC 1 cut(s) 379
SfaNI GCATC 2 cut(s) 446, 565
SfcI CTRYAG 1 cut(s) 417
SfuI TTCGAA 2 cut(s) 501, 1006
SinI GGWCC 1 cut(s) 773
SseBI AGGCCT 1 cut(s) 1146
SsiI CCGC 3 cut(s) 64, 149, 351
SspI AATATT 2 cut(s) 136, 697
SspMI CTAG 1 cut(s) 77
StuI AGGCCT 1 cut(s) 1146
TaaI ACNGT 6 cut(s) 92, 319, 409, 418, 684, 917
TaiI ACGT 4 cut(s) 25, 625, 1204, 1328
TaqI TCGA 8 cut(s) 154, 232, 245, 297, 393, 501, 1006, 1065
TfiI GAWTC 5 cut(s) 284, 395, 539, 842, 923
Tru1I TTAA 8 cut(s) 533, 759, 786, 812, 996, 1076, 1181, 1286
Tru9I TTAA 8 cut(s) 533, 759, 786, 812, 996, 1076, 1181, 1286
TscAI CASTG 2 cut(s) 97, 922
TseFI GTSAC 2 cut(s) 550, 1230
TseI GCWGC 1 cut(s) 353
Tsp45I GTSAC 2 cut(s) 550, 1230
TspRI CASTG 2 cut(s) 97, 922
Tth111I GACNNNGTC 1 cut(s) 1311
VpaK11BI GGWCC 1 cut(s) 773
VspI ATTAAT 1 cut(s) 759
XapI RAATTY 5 cut(s) 238, 462, 495, 635, 1022
XbaI TCTAGA 1 cut(s) 76
XceI RCATGY 1 cut(s) 1110
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.