Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6D

Orthogroup ID

OG0001547

Physical Location & Seq

Genomic Coordinates Reverse (-)

5123619 .. 5128437

Gene Structure 4819 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6DG047800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 543 bp

ATGGAAACTTGCTTTAACGCGGTGTCAGATCCAATGCCCAAACGGAGAAAAAGTAAGAGAGATTTACTTTTGCAAAATGCTGAAAGTGTTGATAAACGCAAACGAAGAAAGACTACATCTGCTGAAACAAGCTGCAATTCTGGTCCGAGTATGTCCAACATTCAAGAAGTTGAAAATGTTGTTTTACATGAACACAGCATTGGACAAGCGTCGTATCAAAGAAACAAGCATGGACCAACTTCTACATATTTGGATTTTGGAGATATGGCTCATGTTTGCACTGATTGTGATGCTCTATTTTGGTTAAATGAATCCAAAAAAAGAGTGTCAAGAAAAGCCGCTCCGATCTATACAAAATGTTGTCAAGAAGGTAGGATCAAACTCCAGACACCGCATCCGACACCACCTTTTTTGGAGAAACTACTTGATCCAAATAATGGTCCACAAAGTGTGCTCTTTAGAGAAAATATAAGAGCCTATAATTCTATGTTTGCGTTTACATCAATTGGAGCCAAAATTGATCGAACAATCAATGATGGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03030 ko03420 ko03430 ko03440 ko03460 map03030 map03420 map03430 map03440 map03460

Pfam Domains

Protein Families

Helitron_like_N Herpes_Helicase PIF1 REPA_OB_2

Protein Analysis

180

Amino Acids

20.35

Weight (kDa)

9.18

Isoelectric Point (pI)

51.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001547)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G51690 AT3G51700 AT5G28780
fragaria_vesca	FvH4_1g12810 FvH4_1g15091 FvH4_1g22681 FvH4_3g02850 FvH4_3g10331 FvH4_5g26611 FvH4_6g21911
malus_domestica	MD09G1257400.v1.1 MD10G1239600.v1.1 MD16G1146300.v1.1
prunus_persica	Prupe.1G200900_v2.0.a1 Prupe.1G234700_v2.0.a1 Prupe.6G165800_v2.0.a1
pyrus_communis	pycom01g15480 pycom03g19960 pycom05g09080 pycom05g09090 pycom05g09100 pycom05g13700 pycom05g27440 pycom06g13860 pycom09g02530 pycom10g28970 pycom11g03190 pycom11g03450 pycom11g03460 pycom15g06510 pycom15g06520 pycom15g09120 pycom15g25220 pycom15g25230 pycom17g19080
rosa_chinensis	RchiOBHm_Chr5g0080791
rosa_multiflora	Rmu_sc0002236.1_g000014 Rmu_sc0004733.1_g000008
rosa_roxburghii	Rroxscaffold_1G00025650 Rroxscaffold_3G00267580
rosa_rugosa	Rorug06G0008800
rosa_samantha	Rh1CG246000 Rh2BG332000 Rh2CG319700 Rh2DG369300 Rh3BG308100 Rh4CG020600 Rh6DG047800
rosa_wichuraiana	Rw4G009260 Rw5G045770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	437
AccBSI	CCGCTC	1 cut(s)	341
AccII	CGCG	1 cut(s)	20
AciI	CCGC	3 cut(s)	20, 339, 392
AclWI	GGATC	3 cut(s)	23, 383, 422
AdeI	CACNNNGTG	1 cut(s)	449
AfiI	CCNNNNNNNGG	1 cut(s)	437
AgsI	TTSAA	2 cut(s)	164, 173
AjuI	GAANNNNNNNTTGG	2 cut(s)	183, 215
AluBI	AGCT	1 cut(s)	132
AluI	AGCT	1 cut(s)	132
Alw21I	GWGCWC	1 cut(s)	456
AlwI	GGATC	3 cut(s)	23, 383, 422
ApeKI	GCWGC	1 cut(s)	132
AspS9I	GGNCC	3 cut(s)	143, 233, 440
AvaII	GGWCC	3 cut(s)	143, 233, 440
BarI	GAAGNNNNNNTAC	2 cut(s)	97, 129
Bbv12I	GWGCWC	1 cut(s)	456
BbvI	GCAGC	1 cut(s)	119
BccI	CCATC	1 cut(s)	530
BisI	GCNGC	2 cut(s)	133, 339
BlsI	GCNGC	2 cut(s)	134, 340
Bme18I	GGWCC	3 cut(s)	143, 233, 440
BmgT120I	GGNCC	3 cut(s)	143, 233, 440
BmiI	GGNNCC	1 cut(s)	511
BmsI	GCATC	2 cut(s)	280, 403
BoxI	GACNNNNGTC	1 cut(s)	208
BpmI	CTGGAG	1 cut(s)	368
BsaXI	ACNNNNNCTCC	2 cut(s)	37, 67
Bsc4I	CCNNNNNNNGG	1 cut(s)	437
BseGI	GGATG	1 cut(s)	394
BseLI	CCNNNNNNNGG	1 cut(s)	437
BseXI	GCAGC	1 cut(s)	119
Bsh1236I	CGCG	1 cut(s)	20
BsiHKAI	GWGCWC	1 cut(s)	456
BslI	CCNNNNNNNGG	1 cut(s)	437
Bsp1286I	GDGCHC	1 cut(s)	456
Bsp143I	GATC	5 cut(s)	28, 345, 375, 427, 520
BspACI	CCGC	3 cut(s)	20, 339, 392
BspFNI	CGCG	1 cut(s)	20
BspLI	GGNNCC	1 cut(s)	511
BspPI	GGATC	3 cut(s)	23, 383, 422
BsrBI	CCGCTC	1 cut(s)	341
BssMI	GATC	5 cut(s)	28, 345, 375, 427, 520
BstF5I	GGATG	1 cut(s)	394
BstFNI	CGCG	1 cut(s)	20
BstKTI	GATC	5 cut(s)	31, 348, 378, 430, 523
BstMBI	GATC	5 cut(s)	28, 345, 375, 427, 520
BstPAI	GACNNNNGTC	1 cut(s)	208
BstUI	CGCG	1 cut(s)	20
BstV1I	GCAGC	1 cut(s)	119
BstX2I	RGATCY	1 cut(s)	28
BstYI	RGATCY	1 cut(s)	28
BtsCI	GGATG	1 cut(s)	394
BtsIMutI	CAGTG	1 cut(s)	279
Cfr13I	GGNCC	3 cut(s)	143, 233, 440
CseI	GACGC	1 cut(s)	198
CspCI	CAANNNNNGTGG	2 cut(s)	393, 428
CviAII	CATG	3 cut(s)	188, 230, 272
CviJI	RGCY	5 cut(s)	132, 269, 338, 476, 512
CviKI_1	RGCY	5 cut(s)	132, 269, 338, 476, 512
DpnI	GATC	5 cut(s)	30, 347, 377, 429, 522
DpnII	GATC	5 cut(s)	28, 345, 375, 427, 520
DraIII	CACNNNGTG	1 cut(s)	449
Eco47I	GGWCC	3 cut(s)	143, 233, 440
FaeI	CATG	3 cut(s)	191, 233, 275
FatI	CATG	3 cut(s)	187, 229, 271
Fnu4HI	GCNGC	2 cut(s)	133, 339
FokI	GGATG	1 cut(s)	381
Fsp4HI	GCNGC	2 cut(s)	133, 339
GluI	GCNGC	2 cut(s)	133, 339
GsuI	CTGGAG	1 cut(s)	368
HgaI	GACGC	1 cut(s)	198
Hin1II	CATG	3 cut(s)	191, 233, 275
HinfI	GANTC	1 cut(s)	311
Hpy166II	GTNNAC	2 cut(s)	443, 498
Hpy188I	TCNGA	4 cut(s)	28, 147, 345, 399
Hpy188III	TCNNGA	4 cut(s)	164, 330, 365, 385
Hpy8I	GTNNAC	2 cut(s)	443, 498
Hpy99I	CGWCG	1 cut(s)	214
HpyAV	CCTTC	1 cut(s)	362
HpyCH4V	TGCA	3 cut(s)	73, 135, 279
Hsp92II	CATG	3 cut(s)	191, 233, 275
Kzo9I	GATC	5 cut(s)	28, 345, 375, 427, 520
LmnI	GCTCC	2 cut(s)	346, 509
LpnPI	CCDG	2 cut(s)	126, 398
Lsp1109I	GCAGC	1 cut(s)	119
LweI	GCATC	2 cut(s)	280, 403
MalI	GATC	5 cut(s)	30, 347, 377, 429, 522
MbiI	CCGCTC	1 cut(s)	341
MboI	GATC	5 cut(s)	28, 345, 375, 427, 520
MboII	GAAGA	1 cut(s)	117
MfeI	CAATTG	1 cut(s)	504
MflI	RGATCY	1 cut(s)	28
MhlI	GDGCHC	1 cut(s)	456
MluCI	AATT	4 cut(s)	136, 481, 504, 516
MmeI	TCCRAC	2 cut(s)	180, 422
MseI	TTAA	2 cut(s)	15, 305
MunI	CAATTG	1 cut(s)	504
MvnI	CGCG	1 cut(s)	20
NdeII	GATC	5 cut(s)	28, 345, 375, 427, 520
NlaIII	CATG	3 cut(s)	191, 233, 275
NlaIV	GGNNCC	1 cut(s)	511
PfeI	GAWTC	1 cut(s)	311
PflMI	CCANNNNNTGG	1 cut(s)	437
PkrI	GCNGC	2 cut(s)	134, 340
PshAI	GACNNNNGTC	1 cut(s)	208
PspN4I	GGNNCC	1 cut(s)	511
PspPI	GGNCC	3 cut(s)	143, 233, 440
PsuI	RGATCY	1 cut(s)	28
SaqAI	TTAA	2 cut(s)	15, 305
SatI	GCNGC	2 cut(s)	133, 339
Sau3AI	GATC	5 cut(s)	28, 345, 375, 427, 520
Sau96I	GGNCC	3 cut(s)	143, 233, 440
SduI	GDGCHC	1 cut(s)	456
SetI	ASST	3 cut(s)	134, 373, 409
SfaNI	GCATC	2 cut(s)	280, 403
SinI	GGWCC	3 cut(s)	143, 233, 440
Sse9I	AATT	4 cut(s)	136, 481, 504, 516
SsiI	CCGC	3 cut(s)	20, 339, 392
TaqI	TCGA	1 cut(s)	523
TasI	AATT	4 cut(s)	136, 481, 504, 516
TauI	GCSGC	1 cut(s)	341
TfiI	GAWTC	1 cut(s)	311
Tru1I	TTAA	2 cut(s)	15, 305
Tru9I	TTAA	2 cut(s)	15, 305
TscAI	CASTG	1 cut(s)	286
TseI	GCWGC	1 cut(s)	132
TspDTI	ATGAA	2 cut(s)	204, 324
TspGWI	ACGGA	1 cut(s)	58
TspRI	CASTG	1 cut(s)	286
Van91I	CCANNNNNTGG	1 cut(s)	437
VpaK11BI	GGWCC	3 cut(s)	143, 233, 440

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.