MD09G1257400.v1.1

G-quadruplex DNA unwinding

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Reverse (-)
32910198 .. 32911401
1204 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1257400.v1.1.491

Sequence Viewer

Length: 210 bp
ATGCTTATAAAATATCTTTTCAAATACATAAACAAAGGTTCAGATCGAGCAAGAATTGTTTTCGAAGAGATTTCAAACAATGAAATATTTGCTTATCTAAATTGTAGATATATATCTCCATATGAAGTTGTTTGGAGATTGTTTGAGTATCCAATTCATATGAGAGAACCTCATGTTGAACGATTGCTAGTGCATCTTCCTTTGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.52

Weight (kDa)

6.83

Isoelectric Point (pI)

28.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 8
AgsI TTSAA 3 cut(s) 22, 75, 179
AsuII TTCGAA 1 cut(s) 63
BciVI GTATCC 1 cut(s) 159
BfaI CTAG 1 cut(s) 188
BfuI GTATCC 1 cut(s) 159
BmsI GCATC 1 cut(s) 202
BplI GAGNNNNNCTC 2 cut(s) 154, 186
Bpu14I TTCGAA 1 cut(s) 63
BsaBI GATNNNNATC 1 cut(s) 112
Bse8I GATNNNNATC 1 cut(s) 112
BseJI GATNNNNATC 1 cut(s) 112
Bsp119I TTCGAA 1 cut(s) 63
Bsp143I GATC 1 cut(s) 43
BspT104I TTCGAA 1 cut(s) 63
BssMI GATC 1 cut(s) 43
Bst6I CTCTTC 1 cut(s) 60
BstBI TTCGAA 1 cut(s) 63
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BsuI GTATCC 1 cut(s) 159
CviAII CATG 1 cut(s) 173
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 60
EarI CTCTTC 1 cut(s) 60
FaeI CATG 1 cut(s) 176
FaiI YATR 9 cut(s) 8, 29, 111, 113, 121, 123, 159, 161, 174
FatI CATG 1 cut(s) 172
FauNDI CATATG 2 cut(s) 121, 159
FspBI CTAG 1 cut(s) 188
FspEI CC 6 cut(s) 21, 118, 132, 165, 183, 188
Hin1II CATG 1 cut(s) 176
Hpy188I TCNGA 1 cut(s) 43
HpyCH4V TGCA 1 cut(s) 193
Hsp92II CATG 1 cut(s) 176
Kzo9I GATC 1 cut(s) 43
LweI GCATC 1 cut(s) 202
MaeI CTAG 1 cut(s) 188
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 2 cut(s) 77, 188
MluCI AATT 3 cut(s) 54, 100, 153
MnlI CCTC 1 cut(s) 180
NdeI CATATG 2 cut(s) 121, 159
NdeII GATC 1 cut(s) 43
NlaIII CATG 1 cut(s) 176
NspV TTCGAA 1 cut(s) 63
PsiI TTATAA 1 cut(s) 8
Sau3AI GATC 1 cut(s) 43
SetI ASST 2 cut(s) 40, 172
SfaNI GCATC 1 cut(s) 202
SfuI TTCGAA 1 cut(s) 63
SgeI CNNG 4 cut(s) 59, 63, 185, 200
Sse9I AATT 3 cut(s) 54, 100, 153
SspI AATATT 1 cut(s) 87
SspMI CTAG 1 cut(s) 188
TaqI TCGA 2 cut(s) 46, 63
TasI AATT 3 cut(s) 54, 100, 153
TspDTI ATGAA 3 cut(s) 96, 138, 146
XspI CTAG 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.