AT4G04555
MYB Family

transcription factor

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Reverse (-)
2265647 .. 2266799
1153 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G04555.1

Sequence Viewer

Length: 321 bp
ATGAGAGGACGGATCGTTAGATCGTACACTAGGTCAAAAGTGCCGCATTGGCGTTGGACAGATGATCTTAATCTCCTTTTTATTCAAGTTGTTGAATTACTTGGTGGCGAAAGAAGGGCAACTCCTAAGGTTATTTTGGATTTTATGGATGTGAAAAACCTCCCAATTTCACATGTGAAAAGCCATCTTCAGATGTATAGGAACAAGAAGAAAGAAGAATCTAGAAAAGAAAGGAGAATGATGCGAGAAATGAGCAGGAGGCAATCTCAACAATACATTCAAATCTACGAAAGGTACAATTGGATATTAGTGAGAAGATAA

Protein Analysis

106

Amino Acids

13.21

Weight (kDa)

10.94

Isoelectric Point (pI)

69.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 44
AclWI GGATC 1 cut(s) 20
AcuI CTGAAG 1 cut(s) 173
AfaI GTAC 2 cut(s) 26, 296
AflIII ACRYGT 1 cut(s) 172
AgsI TTSAA 3 cut(s) 86, 95, 281
AlwI GGATC 1 cut(s) 20
AxyI CCTNAGG 1 cut(s) 126
BccI CCATC 1 cut(s) 192
BfaI CTAG 2 cut(s) 30, 222
BglI GCCNNNNNGGC 1 cut(s) 49
BisI GCNGC 1 cut(s) 44
BlsI GCNGC 1 cut(s) 45
BmsI GCATC 1 cut(s) 231
BplI GAGNNNNNCTC 2 cut(s) 250, 282
BsaBI GATNNNNATC 1 cut(s) 69
Bse21I CCTNAGG 1 cut(s) 126
Bse8I GATNNNNATC 1 cut(s) 69
BseGI GGATG 1 cut(s) 154
BseJI GATNNNNATC 1 cut(s) 69
Bsp143I GATC 3 cut(s) 12, 20, 64
BspACI CCGC 1 cut(s) 44
BspPI GGATC 1 cut(s) 20
BssMI GATC 3 cut(s) 12, 20, 64
BstDEI CTNAG 1 cut(s) 126
BstF5I GGATG 1 cut(s) 154
BstKTI GATC 3 cut(s) 15, 23, 67
BstMBI GATC 3 cut(s) 12, 20, 64
BstMWI GCNNNNNNNGC 1 cut(s) 49
BstNSI RCATGY 1 cut(s) 176
Bsu36I CCTNAGG 1 cut(s) 126
BtsCI GGATG 1 cut(s) 154
Csp6I GTAC 2 cut(s) 25, 295
CviAII CATG 1 cut(s) 173
CviJI RGCY 1 cut(s) 183
CviKI_1 RGCY 1 cut(s) 183
CviQI GTAC 2 cut(s) 25, 295
DdeI CTNAG 1 cut(s) 126
DpnI GATC 3 cut(s) 14, 22, 66
DpnII GATC 3 cut(s) 12, 20, 64
Eco57I CTGAAG 1 cut(s) 173
Eco81I CCTNAGG 1 cut(s) 126
FaeI CATG 1 cut(s) 176
FaiI YATR 3 cut(s) 146, 174, 198
FatI CATG 1 cut(s) 172
Fnu4HI GCNGC 1 cut(s) 44
FokI GGATG 1 cut(s) 161
Fsp4HI GCNGC 1 cut(s) 44
FspBI CTAG 2 cut(s) 30, 222
GluI GCNGC 1 cut(s) 44
Hin1II CATG 1 cut(s) 176
HinfI GANTC 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 27
Hpy188I TCNGA 1 cut(s) 192
Hpy188III TCNNGA 1 cut(s) 222
Hpy8I GTNNAC 1 cut(s) 27
HpyAV CCTTC 1 cut(s) 108
HpyF10VI GCNNNNNNNGC 1 cut(s) 49
HpyF3I CTNAG 1 cut(s) 126
Hsp92II CATG 1 cut(s) 176
Kzo9I GATC 3 cut(s) 12, 20, 64
LpnPI CCDG 1 cut(s) 241
LweI GCATC 1 cut(s) 231
MaeI CTAG 2 cut(s) 30, 222
MalI GATC 3 cut(s) 14, 22, 66
MboI GATC 3 cut(s) 12, 20, 64
MboII GAAGA 3 cut(s) 179, 220, 227
MfeI CAATTG 1 cut(s) 298
MluCI AATT 3 cut(s) 95, 165, 298
MmeI TCCRAC 1 cut(s) 35
MnlI CCTC 2 cut(s) 170, 252
MseI TTAA 1 cut(s) 69
MunI CAATTG 1 cut(s) 298
MwoI GCNNNNNNNGC 1 cut(s) 49
NdeII GATC 3 cut(s) 12, 20, 64
NlaIII CATG 1 cut(s) 176
NspI RCATGY 1 cut(s) 176
PciI ACATGT 1 cut(s) 172
PfeI GAWTC 1 cut(s) 218
PkrI GCNGC 1 cut(s) 45
PscI ACATGT 1 cut(s) 172
RsaI GTAC 2 cut(s) 26, 296
RsaNI GTAC 2 cut(s) 25, 295
SaqAI TTAA 1 cut(s) 69
SatI GCNGC 1 cut(s) 44
Sau3AI GATC 3 cut(s) 12, 20, 64
SetI ASST 4 cut(s) 35, 132, 162, 296
SfaNI GCATC 1 cut(s) 231
SgeI CNNG 8 cut(s) 42, 98, 113, 185, 217, 234, 257, 268
Sse9I AATT 3 cut(s) 95, 165, 298
SsiI CCGC 1 cut(s) 44
SspMI CTAG 2 cut(s) 30, 222
TasI AATT 3 cut(s) 95, 165, 298
TauI GCSGC 1 cut(s) 46
TfiI GAWTC 1 cut(s) 218
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TspGWI ACGGA 1 cut(s) 25
XbaI TCTAGA 1 cut(s) 221
XceI RCATGY 1 cut(s) 176
XspI CTAG 2 cut(s) 30, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.