Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001969.1

Orthogroup ID

OG0001787

Physical Location & Seq

Genomic Coordinates Forward (+)

41980 .. 46364

Gene Structure 4385 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001969.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 468 bp

atggcaacgaacaaggttgaatcaagtgaagggagcttttctaggggatcacacaatggtgaacaactgccagctgaaaggacgagacctactggccagttaactgctatggttagaccttatgttcgctccgaacttcctcggtttcggtggacacctcatctccaccgctgttttgtgcatgcagttgatatccttggaggagaagacagagccactccaaagaagatcttgaggatcatgaatgttgaaggtctcaccatgaatcatgtaaaagccatcttcagtgttggagcgtctcgaggatctgaaaacccgaattcaagctctgatcttcctctccgacctccaaaagcacttccctattggaggaccttgcctgcctcggagcttactccgatctcttcgttttcatcactgacggcaaagccgatatcttcttttgcagtatcgccaccatggatttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

155

Amino Acids

17.1

Weight (kDa)

10.19

Isoelectric Point (pI)

51.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001787)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G14600 AT2G02060 AT2G02060 AT2G02060 AT4G04555 AT4G04580 AT4G04605
fragaria_vesca	FvH4_3g01830 FvH4_3g01830 FvH4_3g01830 FvH4_3g01830 FvH4_3g16530
malus_domestica	MD10G1323600.v1.1
prunus_persica	Prupe.4G018700_v2.0.a1
pyrus_communis	pycom10g27390
rosa_chinensis	RchiOBHm_Chr5g0002671 RchiOBHm_Chr5g0027581
rosa_laevigata	RLG00000008425 RLG00000031051 RLG00000033029 RLG00000033030
rosa_multiflora	Rmu_co8356799.1_g000001 Rmu_sc0001647.1_g000007 Rmu_sc0001969.1_g000009 Rmu_sc0011056.1_g000003
rosa_roxburghii	Rroxscaffold_1G00051950 Rroxscaffold_1G00073200 Rroxscaffold_5G00355280
rosa_rugosa	Rorug04G0398200 Rorug04G0398300
rosa_samantha	Rh2CG329100 Rh2DG367900 Rh4BG160200 Rh4DG156300 Rh5AG021600 Rh5AG194200 Rh5BG024300 Rh5BG192300 Rh5CG023800 Rh5CG212300 Rh5DG022700 Rh5DG022800 Rh5DG194000
rosa_wichuraiana	Rw0G014380 Rw4G013410 Rw5G002010 Rw5G017700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	169
AclWI	GGATC	3 cut(s)	55, 245, 313
AcoI	YGGCCR	1 cut(s)	94
AcsI	RAATTY	1 cut(s)	319
AcuI	CTGAAG	1 cut(s)	268
AfiI	CCNNNNNNNGG	1 cut(s)	369
AgsI	TTSAA	3 cut(s)	20, 251, 324
AleI	CACNNNNGTG	1 cut(s)	57
AluBI	AGCT	4 cut(s)	36, 74, 327, 391
AluI	AGCT	4 cut(s)	36, 74, 327, 391
Alw26I	GTCTC	3 cut(s)	79, 260, 303
AlwI	GGATC	3 cut(s)	55, 245, 313
Ama87I	CYCGRG	1 cut(s)	300
AoxI	GGCC	1 cut(s)	94
ApoI	RAATTY	1 cut(s)	319
ArsI	GACNNNNNNTTYG	2 cut(s)	108, 140
AspS9I	GGNCC	1 cut(s)	372
AsuHPI	GGTGA	2 cut(s)	71, 250
AvaI	CYCGRG	1 cut(s)	300
AvaII	GGWCC	1 cut(s)	372
BalI	TGGCCA	1 cut(s)	96
BbsI	GAAGAC	1 cut(s)	213
BccI	CCATC	1 cut(s)	287
BceAI	ACGGC	1 cut(s)	438
BcoDI	GTCTC	3 cut(s)	79, 260, 303
BfaI	CTAG	1 cut(s)	42
BglII	AGATCT	1 cut(s)	228
Bme18I	GGWCC	1 cut(s)	372
BmeT110I	CYCGRG	1 cut(s)	300
BmgT120I	GGNCC	1 cut(s)	372
BpiI	GAAGAC	1 cut(s)	213
BpuEI	CTTGAG	1 cut(s)	253
BsaI	GGTCTC	2 cut(s)	79, 260
BsaJI	CCNNGG	4 cut(s)	140, 196, 384, 458
BsaXI	ACNNNNNCTCC	2 cut(s)	147, 177
Bsc4I	CCNNNNNNNGG	1 cut(s)	369
Bse1I	ACTGG	2 cut(s)	97, 97
BseDI	CCNNGG	4 cut(s)	140, 196, 384, 458
BseLI	CCNNNNNNNGG	1 cut(s)	369
BseNI	ACTGG	2 cut(s)	97, 97
BseRI	GAGGAG	1 cut(s)	216
BshFI	GGCC	1 cut(s)	96
BsiHKCI	CYCGRG	1 cut(s)	300
BslI	CCNNNNNNNGG	1 cut(s)	369
BsmAI	GTCTC	3 cut(s)	79, 260, 303
BsmBI	CGTCTC	1 cut(s)	303
BsnI	GGCC	1 cut(s)	96
Bso31I	GGTCTC	2 cut(s)	79, 260
BsoBI	CYCGRG	1 cut(s)	300
Bsp143I	GATC	6 cut(s)	47, 228, 237, 305, 331, 399
Bsp19I	CCATGG	1 cut(s)	458
BspACI	CCGC	1 cut(s)	169
BspANI	GGCC	1 cut(s)	96
BspHI	TCATGA	1 cut(s)	240
BspPI	GGATC	3 cut(s)	55, 245, 313
BspTNI	GGTCTC	2 cut(s)	79, 260
BsrI	ACTGG	2 cut(s)	97, 97
BssECI	CCNNGG	4 cut(s)	140, 196, 384, 458
BssMI	GATC	6 cut(s)	47, 228, 237, 305, 331, 399
BssT1I	CCWWGG	2 cut(s)	196, 458
Bst6I	CTCTTC	1 cut(s)	409
BstC8I	GCNNGC	3 cut(s)	72, 183, 381
BstDSI	CCRYGG	1 cut(s)	458
BstENI	CCTNNNNNAGG	1 cut(s)	367
BstKTI	GATC	6 cut(s)	50, 231, 240, 308, 334, 402
BstMAI	GTCTC	3 cut(s)	79, 260, 303
BstMBI	GATC	6 cut(s)	47, 228, 237, 305, 331, 399
BstNSI	RCATGY	1 cut(s)	185
BstV2I	GAAGAC	1 cut(s)	213
BstX2I	RGATCY	2 cut(s)	228, 305
BstYI	RGATCY	2 cut(s)	228, 305
BsuRI	GGCC	1 cut(s)	96
BtgI	CCRYGG	1 cut(s)	458
BtsIMutI	CAGTG	2 cut(s)	292, 416
Cac8I	GCNNGC	3 cut(s)	72, 183, 381
CciI	TCATGA	1 cut(s)	240
Cfr13I	GGNCC	1 cut(s)	372
CseI	GACGC	1 cut(s)	285
CviAII	CATG	5 cut(s)	182, 241, 262, 269, 459
CviJI	RGCY	8 cut(s)	36, 74, 96, 215, 278, 327, 391, 430
CviKI_1	RGCY	8 cut(s)	36, 74, 96, 215, 278, 327, 391, 430
DpnI	GATC	6 cut(s)	49, 230, 239, 307, 333, 401
DpnII	GATC	6 cut(s)	47, 228, 237, 305, 331, 399
EaeI	YGGCCR	1 cut(s)	94
Eam1104I	CTCTTC	1 cut(s)	409
EarI	CTCTTC	1 cut(s)	409
Eco130I	CCWWGG	2 cut(s)	196, 458
Eco31I	GGTCTC	2 cut(s)	79, 260
Eco32I	GATATC	2 cut(s)	193, 435
Eco47I	GGWCC	1 cut(s)	372
Eco57I	CTGAAG	1 cut(s)	268
Eco88I	CYCGRG	1 cut(s)	300
EcoNI	CCTNNNNNAGG	1 cut(s)	367
EcoO109I	RGGNCCY	1 cut(s)	372
EcoRI	GAATTC	1 cut(s)	319
EcoRV	GATATC	2 cut(s)	193, 435
EcoT14I	CCWWGG	2 cut(s)	196, 458
ErhI	CCWWGG	2 cut(s)	196, 458
Esp3I	CGTCTC	1 cut(s)	303
FaeI	CATG	5 cut(s)	185, 244, 265, 272, 462
FaiI	YATR	7 cut(s)	110, 123, 183, 242, 263, 270, 460
FalI	AAGNNNNNCTT	2 cut(s)	215, 247
FatI	CATG	5 cut(s)	181, 240, 261, 268, 458
FspBI	CTAG	1 cut(s)	42
HaeIII	GGCC	1 cut(s)	96
HgaI	GACGC	1 cut(s)	285
Hin1II	CATG	5 cut(s)	185, 244, 265, 272, 462
HincII	GTYRAC	1 cut(s)	102
HindII	GTYRAC	1 cut(s)	102
HinfI	GANTC	2 cut(s)	20, 265
HpaI	GTTAAC	1 cut(s)	102
HphI	GGTGA	2 cut(s)	71, 250
Hpy166II	GTNNAC	3 cut(s)	62, 102, 153
Hpy188I	TCNGA	6 cut(s)	133, 310, 331, 344, 388, 399
Hpy188III	TCNNGA	3 cut(s)	232, 241, 300
Hpy8I	GTNNAC	3 cut(s)	62, 102, 153
HpyAV	CCTTC	2 cut(s)	23, 245
HpyCH4V	TGCA	3 cut(s)	181, 185, 446
Hsp92II	CATG	5 cut(s)	185, 244, 265, 272, 462
KspAI	GTTAAC	1 cut(s)	102
Kzo9I	GATC	6 cut(s)	47, 228, 237, 305, 331, 399
LmnI	GCTCC	4 cut(s)	33, 134, 293, 388
LpnPI	CCDG	4 cut(s)	78, 84, 110, 393
MaeI	CTAG	1 cut(s)	42
MalI	GATC	6 cut(s)	49, 230, 239, 307, 333, 401
MboI	GATC	6 cut(s)	47, 228, 237, 305, 331, 399
MboII	GAAGA	6 cut(s)	218, 238, 274, 326, 396, 429
MflI	RGATCY	2 cut(s)	228, 305
MlsI	TGGCCA	1 cut(s)	96
MluCI	AATT	1 cut(s)	319
MluNI	TGGCCA	1 cut(s)	96
MmeI	TCCRAC	2 cut(s)	271, 367
MnlI	CCTC	9 cut(s)	150, 168, 194, 228, 296, 348, 357, 363, 394
Mox20I	TGGCCA	1 cut(s)	96
MscI	TGGCCA	1 cut(s)	96
MseI	TTAA	1 cut(s)	101
MslI	CAYNNNNRTG	1 cut(s)	57
Msp20I	TGGCCA	1 cut(s)	96
MspA1I	CMGCKG	2 cut(s)	74, 171
NcoI	CCATGG	1 cut(s)	458
NdeII	GATC	6 cut(s)	47, 228, 237, 305, 331, 399
NlaIII	CATG	5 cut(s)	185, 244, 265, 272, 462
NspI	RCATGY	1 cut(s)	185
OliI	CACNNNNGTG	1 cut(s)	57
PaeI	GCATGC	1 cut(s)	185
PaeR7I	CTCGAG	1 cut(s)	300
PagI	TCATGA	1 cut(s)	240
PcsI	WCGNNNNNNNCGW	1 cut(s)	428
PfeI	GAWTC	2 cut(s)	20, 265
PpuMI	RGGWCCY	1 cut(s)	372
Psp5II	RGGWCCY	1 cut(s)	372
PspPI	GGNCC	1 cut(s)	372
PspPPI	RGGWCCY	1 cut(s)	372
PsuI	RGATCY	2 cut(s)	228, 305
PvuII	CAGCTG	1 cut(s)	74
RseI	CAYNNNNRTG	1 cut(s)	57
SaqAI	TTAA	1 cut(s)	101
Sau3AI	GATC	6 cut(s)	47, 228, 237, 305, 331, 399
Sau96I	GGNCC	1 cut(s)	372
Sfr274I	CTCGAG	1 cut(s)	300
SinI	GGWCC	1 cut(s)	372
SlaI	CTCGAG	1 cut(s)	300
SmiMI	CAYNNNNRTG	1 cut(s)	57
SmlI	CTYRAG	2 cut(s)	232, 300
SmoI	CTYRAG	2 cut(s)	232, 300
SphI	GCATGC	1 cut(s)	185
Sse9I	AATT	1 cut(s)	319
SsiI	CCGC	1 cut(s)	169
SspMI	CTAG	1 cut(s)	42
StyI	CCWWGG	2 cut(s)	196, 458
TaqI	TCGA	1 cut(s)	301
TasI	AATT	1 cut(s)	319
TfiI	GAWTC	2 cut(s)	20, 265
Tru1I	TTAA	1 cut(s)	101
Tru9I	TTAA	1 cut(s)	101
TscAI	CASTG	2 cut(s)	292, 423
TspDTI	ATGAA	3 cut(s)	257, 278, 402
TspRI	CASTG	2 cut(s)	292, 423
VpaK11BI	GGWCC	1 cut(s)	372
XagI	CCTNNNNNAGG	1 cut(s)	367
XapI	RAATTY	1 cut(s)	319
XceI	RCATGY	1 cut(s)	185
XhoI	CTCGAG	1 cut(s)	300
XspI	CTAG	1 cut(s)	42

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.