Rh4DG156300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
31287196 .. 31288693
1498 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG156300.1

Sequence Viewer

Length: 300 bp
ATGGCAACCAATAAGGTTGAATCAAGTGAAAGGGAGCTTAATGGTGAACAACTGCCAGCTGAAAGGCCGAGACCTACTGGCCAGTTAACTGCTATGGTTAGACCTTATGTTCGCTCCGAACTACCTCGGTTTCGTGGACACCTCTTCTCCACCGCTGTTTTGTGCATGCAGTTGATATCCTTGGAGGAGAAGACAGATAACAATGATGATAAAAAAACTAAGACTAATAGTAGAGGAGCTATATATGTCACGATGCTTCCATCACTCAACTCATCATCATCAAATGCTTCTTATTCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.05

Weight (kDa)

8.89

Isoelectric Point (pI)

44.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 153
AcoI YGGCCR 1 cut(s) 79
AgsI TTSAA 1 cut(s) 20
AluBI AGCT 3 cut(s) 37, 59, 239
AluI AGCT 3 cut(s) 37, 59, 239
Alw26I GTCTC 1 cut(s) 64
AoxI GGCC 2 cut(s) 65, 79
ArsI GACNNNNNNTTYG 2 cut(s) 93, 125
AsuHPI GGTGA 1 cut(s) 56
BalI TGGCCA 1 cut(s) 81
BbsI GAAGAC 1 cut(s) 197
BccI CCATC 1 cut(s) 268
BcoDI GTCTC 1 cut(s) 64
BfaI CTAG 1 cut(s) 298
BmsI GCATC 1 cut(s) 243
BpiI GAAGAC 1 cut(s) 197
BsaI GGTCTC 1 cut(s) 64
BsaJI CCNNGG 2 cut(s) 125, 180
BsaXI ACNNNNNCTCC 2 cut(s) 131, 161
Bse1I ACTGG 2 cut(s) 82, 82
BseDI CCNNGG 2 cut(s) 125, 180
BseNI ACTGG 2 cut(s) 82, 82
BseRI GAGGAG 2 cut(s) 200, 249
BshFI GGCC 2 cut(s) 67, 81
BsmAI GTCTC 1 cut(s) 64
BsnI GGCC 2 cut(s) 67, 81
Bso31I GGTCTC 1 cut(s) 64
BspACI CCGC 1 cut(s) 153
BspANI GGCC 2 cut(s) 67, 81
BspTNI GGTCTC 1 cut(s) 64
BsrI ACTGG 2 cut(s) 82, 82
BssECI CCNNGG 2 cut(s) 125, 180
BssT1I CCWWGG 1 cut(s) 180
Bst6I CTCTTC 1 cut(s) 149
BstC8I GCNNGC 2 cut(s) 57, 167
BstDEI CTNAG 1 cut(s) 219
BstMAI GTCTC 1 cut(s) 64
BstNSI RCATGY 1 cut(s) 169
BstV2I GAAGAC 1 cut(s) 197
BsuRI GGCC 2 cut(s) 67, 81
Cac8I GCNNGC 2 cut(s) 57, 167
CviAII CATG 1 cut(s) 166
CviJI RGCY 5 cut(s) 37, 59, 67, 81, 239
CviKI_1 RGCY 5 cut(s) 37, 59, 67, 81, 239
DdeI CTNAG 1 cut(s) 219
EaeI YGGCCR 1 cut(s) 79
Eam1104I CTCTTC 1 cut(s) 149
EarI CTCTTC 1 cut(s) 149
Eco130I CCWWGG 1 cut(s) 180
Eco31I GGTCTC 1 cut(s) 64
Eco32I GATATC 1 cut(s) 177
EcoRV GATATC 1 cut(s) 177
EcoT14I CCWWGG 1 cut(s) 180
ErhI CCWWGG 1 cut(s) 180
FaeI CATG 1 cut(s) 169
FaiI YATR 6 cut(s) 95, 108, 167, 242, 244, 246
FatI CATG 1 cut(s) 165
FspBI CTAG 1 cut(s) 298
HaeIII GGCC 2 cut(s) 67, 81
Hin1II CATG 1 cut(s) 169
HincII GTYRAC 1 cut(s) 87
HindII GTYRAC 1 cut(s) 87
HinfI GANTC 1 cut(s) 20
HpaI GTTAAC 1 cut(s) 87
HphI GGTGA 1 cut(s) 56
Hpy166II GTNNAC 3 cut(s) 47, 87, 137
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 250
Hpy8I GTNNAC 3 cut(s) 47, 87, 137
HpyCH4V TGCA 2 cut(s) 165, 169
HpyF3I CTNAG 1 cut(s) 219
Hsp92II CATG 1 cut(s) 169
KspAI GTTAAC 1 cut(s) 87
LmnI GCTCC 3 cut(s) 34, 119, 236
LpnPI CCDG 3 cut(s) 63, 69, 95
LweI GCATC 1 cut(s) 243
MaeI CTAG 1 cut(s) 298
MaeIII GTNAC 1 cut(s) 247
MboII GAAGA 2 cut(s) 136, 202
MlsI TGGCCA 1 cut(s) 81
MluNI TGGCCA 1 cut(s) 81
MnlI CCTC 4 cut(s) 135, 152, 178, 227
Mox20I TGGCCA 1 cut(s) 81
MscI TGGCCA 1 cut(s) 81
MseI TTAA 2 cut(s) 39, 86
Msp20I TGGCCA 1 cut(s) 81
MspA1I CMGCKG 2 cut(s) 59, 155
NlaIII CATG 1 cut(s) 169
NmeAIII GCCGAG 1 cut(s) 93
NmuCI GTSAC 1 cut(s) 247
NspI RCATGY 1 cut(s) 169
PaeI GCATGC 1 cut(s) 169
PfeI GAWTC 1 cut(s) 20
PvuII CAGCTG 1 cut(s) 59
SaqAI TTAA 2 cut(s) 39, 86
SetI ASST 8 cut(s) 18, 39, 61, 76, 106, 127, 144, 241
SfaNI GCATC 1 cut(s) 243
SphI GCATGC 1 cut(s) 169
SsiI CCGC 1 cut(s) 153
SspMI CTAG 1 cut(s) 298
StyI CCWWGG 1 cut(s) 180
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 2 cut(s) 39, 86
Tru9I TTAA 2 cut(s) 39, 86
TseFI GTSAC 1 cut(s) 247
Tsp45I GTSAC 1 cut(s) 247
XceI RCATGY 1 cut(s) 169
XspI CTAG 1 cut(s) 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.