RchiOBHm_Chr5g0027581
MYB Family

transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0001787
Physical Location & Seq
Forward (+)
21508418 .. 21508953
536 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30713

Sequence Viewer

Length: 276 bp
ATGGTTAGACCTTATGTTCGCTCTAAAGTGCCTCGGATTCACTGGACACCTGATCTCCACCGCTGTTTTGTGCATGCAGTTGATATCCTTGGAGGAGCAGACAGAGCTACTCCAAAGAAGATCTTGCGAATCATGAATGTTAAAGGTCTCACCATGAATCATATAAAAAGCCATCTTCAGATGTACAGAAACATGAAAGATGAAGAATTAGTACAAGGTATATGTATTAACACAATTTGTTTTCATACATGCCTCACACCCAAATTCCTGGACTGA

Protein Analysis

91

Amino Acids

10.61

Weight (kDa)

9.64

Isoelectric Point (pI)

29.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 14 - 63 2.2e-09 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 61
AcsI RAATTY 1 cut(s) 263
AcuI CTGAAG 1 cut(s) 161
AfaI GTAC 2 cut(s) 185, 213
AjnI CCWGG 1 cut(s) 267
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
Alw26I GTCTC 1 cut(s) 152
ApoI RAATTY 1 cut(s) 263
ArsI GACNNNNNNTTYG 1 cut(s) 32
AsuHPI GGTGA 1 cut(s) 142
BarI GAAGNNNNNNTAC 2 cut(s) 195, 227
BccI CCATC 1 cut(s) 180
BciT130I CCWGG 1 cut(s) 269
BcoDI GTCTC 1 cut(s) 152
BglII AGATCT 1 cut(s) 120
Bme1390I CCNGG 1 cut(s) 269
BmrFI CCNGG 1 cut(s) 269
BsaI GGTCTC 1 cut(s) 152
BsaJI CCNNGG 2 cut(s) 32, 88
BsaXI ACNNNNNCTCC 2 cut(s) 39, 69
Bse1I ACTGG 1 cut(s) 47
BseBI CCWGG 1 cut(s) 269
BseDI CCNNGG 2 cut(s) 32, 88
BseNI ACTGG 1 cut(s) 47
BseRI GAGGAG 1 cut(s) 108
BsmAI GTCTC 1 cut(s) 152
Bso31I GGTCTC 1 cut(s) 152
Bsp1407I TGTACA 1 cut(s) 183
Bsp143I GATC 2 cut(s) 52, 120
BspACI CCGC 1 cut(s) 61
BspHI TCATGA 1 cut(s) 132
BspTNI GGTCTC 1 cut(s) 152
BsrGI TGTACA 1 cut(s) 183
BsrI ACTGG 1 cut(s) 47
BssECI CCNNGG 2 cut(s) 32, 88
BssMI GATC 2 cut(s) 52, 120
BssT1I CCWWGG 1 cut(s) 88
Bst2UI CCWGG 1 cut(s) 269
BstAUI TGTACA 1 cut(s) 183
BstC8I GCNNGC 1 cut(s) 75
BstKTI GATC 2 cut(s) 55, 123
BstMAI GTCTC 1 cut(s) 152
BstMBI GATC 2 cut(s) 52, 120
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstNI CCWGG 1 cut(s) 269
BstNSI RCATGY 2 cut(s) 77, 252
BstSCI CCNGG 1 cut(s) 267
BstX2I RGATCY 1 cut(s) 120
BstXI CCANNNNNNTGG 1 cut(s) 268
BstYI RGATCY 1 cut(s) 120
BtsIMutI CAGTG 1 cut(s) 40
Cac8I GCNNGC 1 cut(s) 75
CciI TCATGA 1 cut(s) 132
Csp6I GTAC 2 cut(s) 184, 212
CviAII CATG 5 cut(s) 74, 133, 154, 193, 249
CviJI RGCY 2 cut(s) 107, 171
CviKI_1 RGCY 2 cut(s) 107, 171
CviQI GTAC 2 cut(s) 184, 212
DpnI GATC 2 cut(s) 54, 122
DpnII GATC 2 cut(s) 52, 120
Eco130I CCWWGG 1 cut(s) 88
Eco31I GGTCTC 1 cut(s) 152
Eco32I GATATC 1 cut(s) 85
Eco57I CTGAAG 1 cut(s) 161
EcoRII CCWGG 1 cut(s) 267
EcoRV GATATC 1 cut(s) 85
EcoT14I CCWWGG 1 cut(s) 88
ErhI CCWWGG 1 cut(s) 88
FaeI CATG 5 cut(s) 77, 136, 157, 196, 252
FalI AAGNNNNNCTT 2 cut(s) 107, 139
FatI CATG 5 cut(s) 73, 132, 153, 192, 248
Hin1II CATG 5 cut(s) 77, 136, 157, 196, 252
HinfI GANTC 3 cut(s) 37, 129, 157
HphI GGTGA 1 cut(s) 142
Hpy188I TCNGA 2 cut(s) 36, 180
Hpy188III TCNNGA 1 cut(s) 133
HpyCH4V TGCA 2 cut(s) 73, 77
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
Hsp92II CATG 5 cut(s) 77, 136, 157, 196, 252
Kzo9I GATC 2 cut(s) 52, 120
LmnI GCTCC 1 cut(s) 95
LpnPI CCDG 3 cut(s) 28, 63, 254
MalI GATC 2 cut(s) 54, 122
MboI GATC 2 cut(s) 52, 120
MboII GAAGA 3 cut(s) 130, 167, 215
MflI RGATCY 1 cut(s) 120
MluCI AATT 3 cut(s) 206, 234, 263
MnlI CCTC 3 cut(s) 42, 86, 263
MseI TTAA 2 cut(s) 141, 228
MspA1I CMGCKG 1 cut(s) 63
MspR9I CCNGG 1 cut(s) 269
MvaI CCWGG 1 cut(s) 269
MwoI GCNNNNNNNGC 1 cut(s) 104
NdeII GATC 2 cut(s) 52, 120
NlaIII CATG 5 cut(s) 77, 136, 157, 196, 252
NspI RCATGY 2 cut(s) 77, 252
PaeI GCATGC 1 cut(s) 77
PagI TCATGA 1 cut(s) 132
PfeI GAWTC 3 cut(s) 37, 129, 157
PfoI TCCNGGA 1 cut(s) 267
Psp6I CCWGG 1 cut(s) 267
PspGI CCWGG 1 cut(s) 267
PsuI RGATCY 1 cut(s) 120
RsaI GTAC 2 cut(s) 185, 213
RsaNI GTAC 2 cut(s) 184, 212
SaqAI TTAA 2 cut(s) 141, 228
Sau3AI GATC 2 cut(s) 52, 120
ScrFI CCNGG 1 cut(s) 269
SetI ASST 5 cut(s) 13, 52, 109, 148, 220
SphI GCATGC 1 cut(s) 77
Sse9I AATT 3 cut(s) 206, 234, 263
SsiI CCGC 1 cut(s) 61
StyD4I CCNGG 1 cut(s) 267
StyI CCWWGG 1 cut(s) 88
TasI AATT 3 cut(s) 206, 234, 263
TatI WGTACW 2 cut(s) 183, 211
TfiI GAWTC 3 cut(s) 37, 129, 157
Tru1I TTAA 2 cut(s) 141, 228
Tru9I TTAA 2 cut(s) 141, 228
TscAI CASTG 1 cut(s) 47
TspDTI ATGAA 5 cut(s) 149, 170, 209, 216, 233
TspRI CASTG 1 cut(s) 47
XapI RAATTY 1 cut(s) 263
XceI RCATGY 2 cut(s) 77, 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.