FvH4_2g31541

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Forward (+)
24157367 .. 24157845
479 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g31541.t1

Sequence Viewer

Length: 318 bp
ATGGAGGAATTGAAAGCTAGTTTAAAACCCAGAGTTGAGGAGGCTGTGGAGATGGTTGCAACAATTGGTCCAGATAAACCTTGGTTCACTGAAACATTGATGCAAAACAAGCTTGATAGAGGCGATATACTATCTCTTGATCAAGAGGAACTCGTATATTCTGTGATCCATGAAAGCAAGGAAGTGGTTGCAGTAGTTCTACATAAGCTTCGTTTCATAGATAATGCTTACCAAAAGAAACCAATCGAGGCAGGCTTATCAGCCCAAGAGACAAGGAATCATGTAAGAAGCAGTCGATCAGTTACTATATGTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

11.93

Weight (kDa)

5.6

Isoelectric Point (pI)

40.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 160
AgsI TTSAA 1 cut(s) 13
AluBI AGCT 3 cut(s) 17, 112, 208
AluI AGCT 3 cut(s) 17, 112, 208
Alw26I GTCTC 1 cut(s) 263
AlwI GGATC 1 cut(s) 160
AspS9I GGNCC 1 cut(s) 68
AvaII GGWCC 1 cut(s) 68
BccI CCATC 1 cut(s) 46
BclI TGATCA 1 cut(s) 139
BcoDI GTCTC 1 cut(s) 263
BfaI CTAG 1 cut(s) 18
Bme18I GGWCC 1 cut(s) 68
BmgT120I GGNCC 1 cut(s) 68
BmsI GCATC 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 80
BseDI CCNNGG 1 cut(s) 80
BseRI GAGGAG 1 cut(s) 53
BsmAI GTCTC 1 cut(s) 263
Bsp143I GATC 3 cut(s) 139, 165, 296
BspPI GGATC 1 cut(s) 160
BssECI CCNNGG 1 cut(s) 80
BssMI GATC 3 cut(s) 139, 165, 296
BssT1I CCWWGG 1 cut(s) 80
BstC8I GCNNGC 1 cut(s) 253
BstKTI GATC 3 cut(s) 142, 168, 299
BstMAI GTCTC 1 cut(s) 263
BstMBI GATC 3 cut(s) 139, 165, 296
BstMWI GCNNNNNNNGC 1 cut(s) 109
BtsIMutI CAGTG 1 cut(s) 87
Cac8I GCNNGC 1 cut(s) 253
Cfr13I GGNCC 1 cut(s) 68
CviAII CATG 2 cut(s) 170, 281
CviJI RGCY 6 cut(s) 17, 44, 112, 208, 255, 263
CviKI_1 RGCY 6 cut(s) 17, 44, 112, 208, 255, 263
DpnI GATC 3 cut(s) 141, 167, 298
DpnII GATC 3 cut(s) 139, 165, 296
DraI TTTAAA 1 cut(s) 24
Eco130I CCWWGG 1 cut(s) 80
Eco47I GGWCC 1 cut(s) 68
EcoT14I CCWWGG 1 cut(s) 80
ErhI CCWWGG 1 cut(s) 80
FaeI CATG 2 cut(s) 173, 284
FaiI YATR 8 cut(s) 128, 157, 171, 204, 218, 282, 308, 310
FatI CATG 2 cut(s) 169, 280
FbaI TGATCA 1 cut(s) 139
FspBI CTAG 1 cut(s) 18
Hin1II CATG 2 cut(s) 173, 284
HindIII AAGCTT 2 cut(s) 110, 206
HinfI GANTC 1 cut(s) 277
Hpy166II GTNNAC 1 cut(s) 87
Hpy188III TCNNGA 3 cut(s) 71, 137, 143
Hpy8I GTNNAC 1 cut(s) 87
HpyCH4V TGCA 3 cut(s) 59, 103, 191
HpyF10VI GCNNNNNNNGC 1 cut(s) 109
Hsp92II CATG 2 cut(s) 173, 284
Ksp22I TGATCA 1 cut(s) 139
Kzo9I GATC 3 cut(s) 139, 165, 296
LpnPI CCDG 3 cut(s) 43, 84, 237
LweI GCATC 1 cut(s) 90
MaeI CTAG 1 cut(s) 18
MaeIII GTNAC 1 cut(s) 301
MalI GATC 3 cut(s) 141, 167, 298
MboI GATC 3 cut(s) 139, 165, 296
MfeI CAATTG 1 cut(s) 63
MluCI AATT 2 cut(s) 8, 63
MnlI CCTC 5 cut(s) 31, 34, 113, 139, 241
MseI TTAA 1 cut(s) 23
MunI CAATTG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 109
NdeII GATC 3 cut(s) 139, 165, 296
NlaIII CATG 2 cut(s) 173, 284
PfeI GAWTC 1 cut(s) 277
PspPI GGNCC 1 cut(s) 68
SaqAI TTAA 1 cut(s) 23
Sau3AI GATC 3 cut(s) 139, 165, 296
Sau96I GGNCC 1 cut(s) 68
SetI ASST 4 cut(s) 19, 82, 114, 210
SfaNI GCATC 1 cut(s) 90
SinI GGWCC 1 cut(s) 68
Sse9I AATT 2 cut(s) 8, 63
SspMI CTAG 1 cut(s) 18
StyI CCWWGG 1 cut(s) 80
TaqI TCGA 2 cut(s) 246, 295
TasI AATT 2 cut(s) 8, 63
TfiI GAWTC 1 cut(s) 277
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TscAI CASTG 1 cut(s) 94
TspDTI ATGAA 2 cut(s) 186, 205
TspRI CASTG 1 cut(s) 94
VpaK11BI GGWCC 1 cut(s) 68
XcmI CCANNNNNNNNNTGG 1 cut(s) 78
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.