Rmu_sc0012046.1_g000005

Domain of unknown function (DUF3511)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012046.1
Physical Location & Seq
Reverse (-)
16621 .. 16977
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012046.1_g000005.1.cds

Sequence Viewer

Length: 357 bp
atggctgactataacagatcaaagtcctacggtggcagtgggactatgcagatggataactactatggacccccaagagcaccacccagttcttatgagatcaggagttacagtatttcctatgcacaggcccagatggggaattataattacaacaacagggatttgaagaaggggaaggctcattctaggtcaaagtcttcttcttgggctttggctgatcctgagttgcagaggaagaagagggttgctagctacaagatgtattctgttgaaggaaaggtgaagggctccttcagaaacagcttcagatggcttaaggttaagtgcagagaattgatttatgggctatcctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.58

Weight (kDa)

10.0

Isoelectric Point (pI)

44.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 147
AclWI GGATC 1 cut(s) 215
AcuI CTGAAG 2 cut(s) 280, 292
AfiI CCNNNNNNNGG 1 cut(s) 138
AflII CTTAAG 1 cut(s) 317
AgsI TTSAA 2 cut(s) 169, 275
AluBI AGCT 2 cut(s) 255, 306
AluI AGCT 2 cut(s) 255, 306
Alw21I GWGCWC 1 cut(s) 82
AlwI GGATC 1 cut(s) 215
AoxI GGCC 1 cut(s) 129
AspS9I GGNCC 2 cut(s) 68, 130
AsuHPI GGTGA 1 cut(s) 295
AsuNHI GCTAGC 1 cut(s) 251
AvaII GGWCC 1 cut(s) 68
BanII GRGCYC 1 cut(s) 293
BbsI GAAGAC 1 cut(s) 192
Bbv12I GWGCWC 1 cut(s) 82
BccI CCATC 3 cut(s) 46, 130, 306
BfaI CTAG 2 cut(s) 189, 252
BfrI CTTAAG 1 cut(s) 317
Bme18I GGWCC 1 cut(s) 68
BmgT120I GGNCC 2 cut(s) 68, 130
BmiI GGNNCC 2 cut(s) 70, 292
BmrI ACTGGG 1 cut(s) 81
BmtI GCTAGC 1 cut(s) 255
BmuI ACTGGG 1 cut(s) 81
BpiI GAAGAC 1 cut(s) 192
BsaXI ACNNNNNCTCC 2 cut(s) 97, 127
Bsc4I CCNNNNNNNGG 1 cut(s) 138
Bse1I ACTGG 1 cut(s) 87
BseLI CCNNNNNNNGG 1 cut(s) 138
BseMII CTCAG 1 cut(s) 216
BseNI ACTGG 1 cut(s) 87
BsgI GTGCAG 1 cut(s) 349
BshFI GGCC 1 cut(s) 131
BsiHKAI GWGCWC 1 cut(s) 82
BslFI GGGAC 1 cut(s) 55
BslI CCNNNNNNNGG 1 cut(s) 138
BsmFI GGGAC 1 cut(s) 55
BsnI GGCC 1 cut(s) 131
Bsp1286I GDGCHC 2 cut(s) 82, 293
Bsp143I GATC 3 cut(s) 17, 99, 220
BspANI GGCC 1 cut(s) 131
BspCNI CTCAG 1 cut(s) 217
BspLI GGNNCC 2 cut(s) 70, 292
BspOI GCTAGC 1 cut(s) 255
BspPI GGATC 1 cut(s) 215
BspTI CTTAAG 1 cut(s) 317
BsrI ACTGG 1 cut(s) 87
BssMI GATC 3 cut(s) 17, 99, 220
Bst4CI ACNGT 2 cut(s) 32, 113
Bst6I CTCTTC 1 cut(s) 236
BstAFI CTTAAG 1 cut(s) 317
BstC8I GCNNGC 1 cut(s) 253
BstDEI CTNAG 1 cut(s) 225
BstKTI GATC 3 cut(s) 20, 102, 223
BstMBI GATC 3 cut(s) 17, 99, 220
BstV2I GAAGAC 1 cut(s) 192
BsuRI GGCC 1 cut(s) 131
BtsI GCAGTG 1 cut(s) 43
BtsIMutI CAGTG 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 253
Cfr13I GGNCC 2 cut(s) 68, 130
DdeI CTNAG 1 cut(s) 225
DpnI GATC 3 cut(s) 19, 101, 222
DpnII GATC 3 cut(s) 17, 99, 220
Eam1104I CTCTTC 1 cut(s) 236
EarI CTCTTC 1 cut(s) 236
Eco24I GRGCYC 1 cut(s) 293
Eco47I GGWCC 1 cut(s) 68
Eco57I CTGAAG 2 cut(s) 280, 292
EcoT38I GRGCYC 1 cut(s) 293
FaiI YATR 7 cut(s) 12, 47, 66, 96, 123, 147, 345
FalI AAGNNNNNCTT 2 cut(s) 278, 310
FaqI GGGAC 1 cut(s) 55
FriOI GRGCYC 1 cut(s) 293
FspBI CTAG 2 cut(s) 189, 252
HaeIII GGCC 1 cut(s) 131
HphI GGTGA 1 cut(s) 295
Hpy188I TCNGA 2 cut(s) 299, 311
Hpy188III TCNNGA 3 cut(s) 103, 224, 354
HpyAV CCTTC 5 cut(s) 166, 172, 269, 280, 304
HpyCH4III ACNGT 2 cut(s) 32, 113
HpyCH4V TGCA 4 cut(s) 49, 125, 232, 330
HpyF3I CTNAG 1 cut(s) 225
Kzo9I GATC 3 cut(s) 17, 99, 220
LmnI GCTCC 1 cut(s) 296
LpnPI CCDG 6 cut(s) 88, 100, 113, 145, 146, 237
MaeI CTAG 2 cut(s) 189, 252
MaeIII GTNAC 1 cut(s) 107
MalI GATC 3 cut(s) 19, 101, 222
MboI GATC 3 cut(s) 17, 99, 220
MboII GAAGA 5 cut(s) 181, 192, 195, 250, 253
MhlI GDGCHC 2 cut(s) 82, 293
MluCI AATT 3 cut(s) 142, 148, 335
MnlI CCTC 2 cut(s) 228, 237
MseI TTAA 2 cut(s) 318, 324
MspCI CTTAAG 1 cut(s) 317
NdeII GATC 3 cut(s) 17, 99, 220
NheI GCTAGC 1 cut(s) 251
NlaIV GGNNCC 2 cut(s) 70, 292
PsiI TTATAA 1 cut(s) 147
PspN4I GGNNCC 2 cut(s) 70, 292
PspPI GGNCC 2 cut(s) 68, 130
SaqAI TTAA 2 cut(s) 318, 324
Sau3AI GATC 3 cut(s) 17, 99, 220
Sau96I GGNCC 2 cut(s) 68, 130
SduI GDGCHC 2 cut(s) 82, 293
SetI ASST 5 cut(s) 194, 257, 285, 308, 324
SinI GGWCC 1 cut(s) 68
SmlI CTYRAG 1 cut(s) 317
SmoI CTYRAG 1 cut(s) 317
Sse9I AATT 3 cut(s) 142, 148, 335
SspMI CTAG 2 cut(s) 189, 252
TaaI ACNGT 2 cut(s) 32, 113
TasI AATT 3 cut(s) 142, 148, 335
Tru1I TTAA 2 cut(s) 318, 324
Tru9I TTAA 2 cut(s) 318, 324
TscAI CASTG 1 cut(s) 43
TspRI CASTG 1 cut(s) 43
Vha464I CTTAAG 1 cut(s) 317
VpaK11BI GGWCC 1 cut(s) 68
XspI CTAG 2 cut(s) 189, 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.