Rh6CG517500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
67452425 .. 67452691
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG517500.1

Sequence Viewer

Length: 159 bp
ATGGAGAAAGTGGATCCTAAATTAGAAGTCAAAATCAAAGAGGCTAAGAAGCTGATTGCAAAGATGGCTCAAGATAAACTTCAGTTCACCTATACATTAGAAGAAAAGATATTTGATGAGTTCTCTTTGGAGTCGTGGTTGCGAACTTGCGATACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.21

Weight (kDa)

5.33

Isoelectric Point (pI)

28.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 8, 21
AcuI CTGAAG 1 cut(s) 65
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
AlwI GGATC 2 cut(s) 8, 21
AsuHPI GGTGA 1 cut(s) 79
BamHI GGATCC 1 cut(s) 13
BccI CCATC 1 cut(s) 58
BmiI GGNNCC 1 cut(s) 15
BpuEI CTTGAG 1 cut(s) 54
BsaXI ACNNNNNCTCC 2 cut(s) 122, 152
Bsp143I GATC 1 cut(s) 13
BspLI GGNNCC 1 cut(s) 15
BspPI GGATC 2 cut(s) 8, 21
BssMI GATC 1 cut(s) 13
BstDEI CTNAG 1 cut(s) 45
BstKTI GATC 1 cut(s) 16
BstMBI GATC 1 cut(s) 13
BstMWI GCNNNNNNNGC 1 cut(s) 65
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
CviJI RGCY 3 cut(s) 44, 52, 68
CviKI_1 RGCY 3 cut(s) 44, 52, 68
DdeI CTNAG 1 cut(s) 45
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
Eco57I CTGAAG 1 cut(s) 65
FaiI YATR 1 cut(s) 93
FalI AAGNNNNNCTT 2 cut(s) 63, 95
FspEI CC 6 cut(s) 26, 30, 50, 103, 113, 121
HinfI GANTC 1 cut(s) 131
HphI GGTGA 1 cut(s) 79
Hpy166II GTNNAC 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 71
Hpy8I GTNNAC 1 cut(s) 87
HpyCH4V TGCA 1 cut(s) 59
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
HpyF3I CTNAG 1 cut(s) 45
Kzo9I GATC 1 cut(s) 13
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MboII GAAGA 1 cut(s) 113
MflI RGATCY 1 cut(s) 13
MluCI AATT 1 cut(s) 20
MlyI GAGTC 1 cut(s) 140
MnlI CCTC 1 cut(s) 34
MwoI GCNNNNNNNGC 1 cut(s) 65
NdeII GATC 1 cut(s) 13
NlaIV GGNNCC 1 cut(s) 15
PleI GAGTC 1 cut(s) 139
PpsI GAGTC 1 cut(s) 139
PspN4I GGNNCC 1 cut(s) 15
PsrI GAACNNNNNNTAC 1 cut(s) 136
PsuI RGATCY 1 cut(s) 13
Sau3AI GATC 1 cut(s) 13
SchI GAGTC 1 cut(s) 140
SetI ASST 3 cut(s) 54, 92, 158
SgeI CNNG 2 cut(s) 83, 147
SmlI CTYRAG 1 cut(s) 69
SmoI CTYRAG 1 cut(s) 69
Sse9I AATT 1 cut(s) 20
TasI AATT 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.