FvH4_6g42500

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Reverse (-)
33108383 .. 33108682
300 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g42500.t1

Sequence Viewer

Length: 300 bp
ATGGCATTAGCAATATCTCCACTGCTCATTCTGGTTCTGAGTACTACTGTGTTAGCCATGGCCAGTACTCATCATGAGTTCAAAGAAACCAAAATGTCTATGTACATGCACGACTTCACCGCCGGTCCAAATATCACGGATATACCAGTTGCTGGTATTGCCGGAAAGCTTTGGGTGTTCAATCAGTTTGGCACAATTTATGTCAACGACGACTCCTTATACCGAAGGTCCGAGCCGGAATTCTACAGCAGTTGGCCGAGCACAGGGTTTTGCTGTAACAGCATCACTAGACGGACGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.11

Weight (kDa)

6.24

Isoelectric Point (pI)

67.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 30 - 78 9.9e-08 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 152
AciI CCGC 1 cut(s) 120
AcoI YGGCCR 2 cut(s) 60, 254
AcsI RAATTY 1 cut(s) 239
AfaI GTAC 3 cut(s) 43, 67, 104
AfiI CCNNNNNNNGG 2 cut(s) 152, 263
AgsI TTSAA 2 cut(s) 82, 181
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
Alw21I GWGCWC 1 cut(s) 263
AlwNI CAGNNNCTG 1 cut(s) 152
AoxI GGCC 2 cut(s) 60, 254
ApoI RAATTY 1 cut(s) 239
AspS9I GGNCC 2 cut(s) 125, 228
AsuHPI GGTGA 1 cut(s) 109
AvaII GGWCC 2 cut(s) 125, 228
BalI TGGCCA 1 cut(s) 62
Bbv12I GWGCWC 1 cut(s) 263
BfaI CTAG 1 cut(s) 288
BfmI CTRYAG 1 cut(s) 244
BmcAI AGTACT 2 cut(s) 43, 67
Bme18I GGWCC 2 cut(s) 125, 228
BmgT120I GGNCC 2 cut(s) 125, 228
BmsI GCATC 1 cut(s) 291
BsaJI CCNNGG 1 cut(s) 57
BsaXI ACNNNNNCTCC 2 cut(s) 197, 227
Bsc4I CCNNNNNNNGG 2 cut(s) 152, 263
Bse118I RCCGGY 1 cut(s) 122
Bse1I ACTGG 2 cut(s) 63, 146
BseDI CCNNGG 1 cut(s) 57
BseLI CCNNNNNNNGG 2 cut(s) 152, 263
BseMII CTCAG 1 cut(s) 29
BseNI ACTGG 2 cut(s) 63, 146
BshFI GGCC 2 cut(s) 62, 256
BsiHKAI GWGCWC 1 cut(s) 263
BsiSI CCGG 3 cut(s) 123, 162, 236
BslI CCNNNNNNNGG 2 cut(s) 152, 263
BsnI GGCC 2 cut(s) 62, 256
Bsp1286I GDGCHC 1 cut(s) 263
Bsp1407I TGTACA 1 cut(s) 102
Bsp19I CCATGG 1 cut(s) 57
BspACI CCGC 1 cut(s) 120
BspANI GGCC 2 cut(s) 62, 256
BspCNI CTCAG 1 cut(s) 30
BspHI TCATGA 1 cut(s) 73
BsrFI RCCGGY 1 cut(s) 122
BsrGI TGTACA 1 cut(s) 102
BsrI ACTGG 2 cut(s) 63, 146
BssAI RCCGGY 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 57
BssT1I CCWWGG 1 cut(s) 57
Bst4CI ACNGT 1 cut(s) 49
BstAUI TGTACA 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 38
BstDSI CCRYGG 1 cut(s) 57
BstMWI GCNNNNNNNGC 2 cut(s) 158, 279
BstNSI RCATGY 1 cut(s) 109
BstSFI CTRYAG 1 cut(s) 244
BsuRI GGCC 2 cut(s) 62, 256
BtgI CCRYGG 1 cut(s) 57
BtsI GCAGTG 1 cut(s) 20
BtsIMutI CAGTG 1 cut(s) 20
CaiI CAGNNNCTG 1 cut(s) 152
CciI TCATGA 1 cut(s) 73
Cfr10I RCCGGY 1 cut(s) 122
Cfr13I GGNCC 2 cut(s) 125, 228
Csp6I GTAC 3 cut(s) 42, 66, 103
CviAII CATG 3 cut(s) 58, 74, 106
CviJI RGCY 5 cut(s) 56, 62, 169, 235, 256
CviKI_1 RGCY 5 cut(s) 56, 62, 169, 235, 256
CviQI GTAC 3 cut(s) 42, 66, 103
DdeI CTNAG 1 cut(s) 38
EaeI YGGCCR 2 cut(s) 60, 254
Eco130I CCWWGG 1 cut(s) 57
Eco47I GGWCC 2 cut(s) 125, 228
EcoRI GAATTC 1 cut(s) 239
EcoT14I CCWWGG 1 cut(s) 57
ErhI CCWWGG 1 cut(s) 57
FaeI CATG 3 cut(s) 61, 77, 109
FaiI YATR 7 cut(s) 59, 75, 101, 107, 143, 201, 220
FatI CATG 3 cut(s) 57, 73, 105
FspBI CTAG 1 cut(s) 288
HaeIII GGCC 2 cut(s) 62, 256
HapII CCGG 3 cut(s) 123, 162, 236
Hin1II CATG 3 cut(s) 61, 77, 109
HincII GTYRAC 1 cut(s) 205
HindII GTYRAC 1 cut(s) 205
HindIII AAGCTT 1 cut(s) 167
HinfI GANTC 1 cut(s) 212
HpaII CCGG 3 cut(s) 123, 162, 236
HphI GGTGA 1 cut(s) 109
Hpy166II GTNNAC 1 cut(s) 205
Hpy188I TCNGA 2 cut(s) 39, 232
Hpy188III TCNNGA 1 cut(s) 74
Hpy8I GTNNAC 1 cut(s) 205
Hpy99I CGWCG 1 cut(s) 212
HpyAV CCTTC 1 cut(s) 219
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4IV ACGT 1 cut(s) 296
HpyCH4V TGCA 1 cut(s) 109
HpyF10VI GCNNNNNNNGC 2 cut(s) 158, 279
HpyF3I CTNAG 1 cut(s) 38
HpySE526I ACGT 1 cut(s) 296
Hsp92II CATG 3 cut(s) 61, 77, 109
LpnPI CCDG 8 cut(s) 17, 76, 136, 138, 159, 175, 249, 249
LweI GCATC 1 cut(s) 291
MaeI CTAG 1 cut(s) 288
MaeII ACGT 1 cut(s) 296
MaeIII GTNAC 1 cut(s) 275
MhlI GDGCHC 1 cut(s) 263
MlsI TGGCCA 1 cut(s) 62
MluCI AATT 2 cut(s) 195, 239
MluNI TGGCCA 1 cut(s) 62
MlyI GAGTC 1 cut(s) 206
Mox20I TGGCCA 1 cut(s) 62
MscI TGGCCA 1 cut(s) 62
Msp20I TGGCCA 1 cut(s) 62
MspI CCGG 3 cut(s) 123, 162, 236
MwoI GCNNNNNNNGC 2 cut(s) 158, 279
NcoI CCATGG 1 cut(s) 57
NlaIII CATG 3 cut(s) 61, 77, 109
NmeAIII GCCGAG 1 cut(s) 282
NspI RCATGY 1 cut(s) 109
PagI TCATGA 1 cut(s) 73
PflMI CCANNNNNTGG 1 cut(s) 152
PleI GAGTC 1 cut(s) 206
PpsI GAGTC 1 cut(s) 206
PspPI GGNCC 2 cut(s) 125, 228
PstNI CAGNNNCTG 1 cut(s) 152
RsaI GTAC 3 cut(s) 43, 67, 104
RsaNI GTAC 3 cut(s) 42, 66, 103
Sau96I GGNCC 2 cut(s) 125, 228
ScaI AGTACT 2 cut(s) 43, 67
SchI GAGTC 1 cut(s) 206
SduI GDGCHC 1 cut(s) 263
SetI ASST 3 cut(s) 171, 230, 299
SfaNI GCATC 1 cut(s) 291
SfcI CTRYAG 1 cut(s) 244
SinI GGWCC 2 cut(s) 125, 228
Sse9I AATT 2 cut(s) 195, 239
SsiI CCGC 1 cut(s) 120
SspMI CTAG 1 cut(s) 288
StyI CCWWGG 1 cut(s) 57
TaaI ACNGT 1 cut(s) 49
TaiI ACGT 1 cut(s) 299
TasI AATT 2 cut(s) 195, 239
TatI WGTACW 3 cut(s) 41, 65, 102
TscAI CASTG 1 cut(s) 27
TspGWI ACGGA 1 cut(s) 152
TspRI CASTG 1 cut(s) 27
Van91I CCANNNNNTGG 1 cut(s) 152
VpaK11BI GGWCC 2 cut(s) 125, 228
XapI RAATTY 1 cut(s) 239
XceI RCATGY 1 cut(s) 109
XspI CTAG 1 cut(s) 288
ZrmI AGTACT 2 cut(s) 43, 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.