MD09G1070400.v1.1

Dirigent protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
4871958 .. 4872377
420 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1070400.v1.1.491

Sequence Viewer

Length: 420 bp
ATGACTTCTTATCTGGTGCAAAATATCACAGATGTTGCGTTTGCAGGTATTCCCGGCAAGACTTGGAACTACAATCAATTTGCCACTGTTTATGCGGAGGATGCCCCTTTAACGGAGGGCATGGACCTAAAATCCGCCTCCGTTGGCCGGATACAAGGCATGTTTATGGTATCGTCATTGGATGGACGTAATTCCTACGATATGTTATCAATTTTATTCACAAACAAGAAGTACAATGGAAGCACTCTACAGATACAAGGAATTGATAAGCAATTCGAGCAACATAGAGAATTATCGGTTGTTTCAGGTACCGGAAAGTTTCGATTTGTTCGAGGATTTATTACGTGTAATACGGTTTTTGTGGACATTCCAAATGCATATTTTGTTACACAATGCAACGTTACAGTAAAACACTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

140

Amino Acids

15.61

Weight (kDa)

7.75

Isoelectric Point (pI)

19.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 8 - 136 2.4e-34 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 35
Acc65I GGTACC 1 cut(s) 308
AccB1I GGYRCC 1 cut(s) 308
AciI CCGC 2 cut(s) 95, 135
AclI AACGTT 1 cut(s) 399
AcoI YGGCCR 1 cut(s) 145
AfaI GTAC 2 cut(s) 233, 310
AfiI CCNNNNNNNGG 2 cut(s) 112, 147
AflIII ACRYGT 1 cut(s) 344
AoxI GGCC 1 cut(s) 145
Asp718I GGTACC 1 cut(s) 308
AspS9I GGNCC 1 cut(s) 124
AsuC2I CCSGG 1 cut(s) 54
AvaII GGWCC 1 cut(s) 124
BanI GGYRCC 1 cut(s) 308
BccI CCATC 1 cut(s) 176
BciVI GTATCC 1 cut(s) 144
BcnI CCSGG 1 cut(s) 54
BfaI CTAG 1 cut(s) 418
BfmI CTRYAG 1 cut(s) 248
BfuAI ACCTGC 1 cut(s) 35
BfuI GTATCC 1 cut(s) 144
Bme1390I CCNGG 1 cut(s) 54
Bme18I GGWCC 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 124
BmiI GGNNCC 1 cut(s) 310
BmrFI CCNGG 1 cut(s) 54
BmsI GCATC 1 cut(s) 91
BpuMI CCSGG 1 cut(s) 54
BsaAI YACGTR 1 cut(s) 345
BsaWI WCCGGW 1 cut(s) 311
Bsc4I CCNNNNNNNGG 2 cut(s) 112, 147
BseGI GGATG 2 cut(s) 106, 187
BseLI CCNNNNNNNGG 2 cut(s) 112, 147
BshFI GGCC 1 cut(s) 147
BshNI GGYRCC 1 cut(s) 308
BsiSI CCGG 3 cut(s) 54, 148, 312
BslI CCNNNNNNNGG 2 cut(s) 112, 147
BsnI GGCC 1 cut(s) 147
BspACI CCGC 2 cut(s) 95, 135
BspANI GGCC 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 310
BspMI ACCTGC 1 cut(s) 35
BspT107I GGYRCC 1 cut(s) 308
Bst4CI ACNGT 3 cut(s) 88, 355, 406
BstBAI YACGTR 1 cut(s) 345
BstF5I GGATG 2 cut(s) 106, 187
BstMWI GCNNNNNNNGC 2 cut(s) 101, 277
BstNSI RCATGY 1 cut(s) 163
BstSCI CCNGG 1 cut(s) 52
BstSFI CTRYAG 1 cut(s) 248
BsuI GTATCC 1 cut(s) 144
BsuRI GGCC 1 cut(s) 147
BtsCI GGATG 2 cut(s) 106, 187
BtsIMutI CAGTG 1 cut(s) 84
BveI ACCTGC 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 124
Csp6I GTAC 2 cut(s) 232, 309
CviAII CATG 2 cut(s) 121, 160
CviJI RGCY 1 cut(s) 147
CviKI_1 RGCY 1 cut(s) 147
CviQI GTAC 2 cut(s) 232, 309
EaeI YGGCCR 1 cut(s) 145
EciI GGCGGA 1 cut(s) 124
Eco47I GGWCC 1 cut(s) 124
EcoT22I ATGCAT 1 cut(s) 379
FaeI CATG 2 cut(s) 124, 163
FaiI YATR 7 cut(s) 93, 122, 161, 167, 203, 285, 379
FatI CATG 2 cut(s) 120, 159
FokI GGATG 2 cut(s) 113, 194
FspBI CTAG 1 cut(s) 418
HaeIII GGCC 1 cut(s) 147
HapII CCGG 3 cut(s) 54, 148, 312
Hin1II CATG 2 cut(s) 124, 163
HpaII CCGG 3 cut(s) 54, 148, 312
Hpy166II GTNNAC 1 cut(s) 364
Hpy8I GTNNAC 1 cut(s) 364
HpyCH4III ACNGT 3 cut(s) 88, 355, 406
HpyCH4IV ACGT 3 cut(s) 187, 344, 399
HpyCH4V TGCA 4 cut(s) 19, 44, 377, 396
HpyF10VI GCNNNNNNNGC 2 cut(s) 101, 277
HpySE526I ACGT 3 cut(s) 187, 344, 399
Hsp92II CATG 2 cut(s) 124, 163
KpnI GGTACC 1 cut(s) 312
LpnPI CCDG 5 cut(s) 30, 67, 161, 291, 325
LweI GCATC 1 cut(s) 91
MaeI CTAG 1 cut(s) 418
MaeII ACGT 3 cut(s) 187, 344, 399
MaeIII GTNAC 2 cut(s) 385, 400
MluCI AATT 6 cut(s) 77, 190, 210, 261, 272, 290
MnlI CCTC 4 cut(s) 91, 109, 148, 326
Mph1103I ATGCAT 1 cut(s) 379
MseI TTAA 1 cut(s) 110
MslI CAYNNNNRTG 1 cut(s) 164
MspI CCGG 3 cut(s) 54, 148, 312
MspR9I CCNGG 1 cut(s) 54
MwoI GCNNNNNNNGC 2 cut(s) 101, 277
NciI CCSGG 1 cut(s) 54
NlaIII CATG 2 cut(s) 124, 163
NlaIV GGNNCC 1 cut(s) 310
NsiI ATGCAT 1 cut(s) 379
NspI RCATGY 1 cut(s) 163
PcsI WCGNNNNNNNCGW 1 cut(s) 328
Ppu21I YACGTR 1 cut(s) 345
Psp1406I AACGTT 1 cut(s) 399
PspN4I GGNNCC 1 cut(s) 310
PspPI GGNCC 1 cut(s) 124
RsaI GTAC 2 cut(s) 233, 310
RsaNI GTAC 2 cut(s) 232, 309
RseI CAYNNNNRTG 1 cut(s) 164
SaqAI TTAA 1 cut(s) 110
Sau96I GGNCC 1 cut(s) 124
ScrFI CCNGG 1 cut(s) 54
SetI ASST 6 cut(s) 49, 129, 190, 310, 347, 402
SfaNI GCATC 1 cut(s) 91
SfcI CTRYAG 1 cut(s) 248
SinI GGWCC 1 cut(s) 124
SmiMI CAYNNNNRTG 1 cut(s) 164
Sse9I AATT 6 cut(s) 77, 190, 210, 261, 272, 290
SsiI CCGC 2 cut(s) 95, 135
SspMI CTAG 1 cut(s) 418
StyD4I CCNGG 1 cut(s) 52
TaaI ACNGT 3 cut(s) 88, 355, 406
TaiI ACGT 3 cut(s) 190, 347, 402
TaqI TCGA 3 cut(s) 276, 322, 331
TasI AATT 6 cut(s) 77, 190, 210, 261, 272, 290
TatI WGTACW 1 cut(s) 231
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
TscAI CASTG 1 cut(s) 91
TspGWI ACGGA 2 cut(s) 128, 130
TspRI CASTG 1 cut(s) 91
VpaK11BI GGWCC 1 cut(s) 124
XceI RCATGY 1 cut(s) 163
XspI CTAG 1 cut(s) 418
Zsp2I ATGCAT 1 cut(s) 379
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.