FvH4_6g42510

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0001118
Physical Location & Seq
Reverse (-)
33109666 .. 33110404
739 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g42510.t1

Sequence Viewer

Length: 477 bp
ATGTCAAAGATCCTCAGCGATTACGCTAAGCTTAATTTAAAGGAACTCATGTACTTACACGACTTCGCCGCCGGTCCAAATATCACGGATATACCAATTGCAGGCATTCCCGGAAAGCTTTGGAGGTATGATCAATTTGGAACAGTTTACTTCAACGACGACCCAATAACCAAAGGACCAAGCCGTAATTCAGAAGTAGTTGGCCGAGCACAGGGTTCTGCAATAACAGTATCACTAGACGGACGTAACGTCCTATCTCTTATGTCGATTGTGTTCACAAACAAGAAGTACAATGGCAGCACTATTGAGATACAAGGCAACTATAAGCAATTTGAGCCGAGTACAGAGGTTCCTGTGGTTTCAGGTACAGGGAAGTTTCGGTTTGCAAGGGGATATTCTATTTTTGGAACTTATTTCTTCGACATTCCAAGTGGCTACTCTATTATACGCTGCAATATTACTGTGCAACACTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

159

Amino Acids

17.63

Weight (kDa)

8.95

Isoelectric Point (pI)

36.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 17 - 155 8.8e-42 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 69
AclWI GGATC 1 cut(s) 4
AcoI YGGCCR 1 cut(s) 202
AfaI GTAC 4 cut(s) 53, 290, 343, 367
AfiI CCNNNNNNNGG 2 cut(s) 101, 211
AgsI TTSAA 1 cut(s) 154
AhdI GACNNNNNGTC 1 cut(s) 248
AjuI GAANNNNNNNTTGG 2 cut(s) 172, 204
AluBI AGCT 2 cut(s) 31, 118
AluI AGCT 2 cut(s) 31, 118
Alw21I GWGCWC 1 cut(s) 211
AlwI GGATC 1 cut(s) 4
AoxI GGCC 1 cut(s) 202
ApeKI GCWGC 2 cut(s) 297, 450
AspS9I GGNCC 2 cut(s) 74, 176
AsuC2I CCSGG 1 cut(s) 111
AvaII GGWCC 2 cut(s) 74, 176
Bbv12I GWGCWC 1 cut(s) 211
BbvCI CCTCAGC 1 cut(s) 14
BbvI GCAGC 2 cut(s) 309, 437
BceAI ACGGC 1 cut(s) 168
BclI TGATCA 1 cut(s) 130
BcnI CCSGG 1 cut(s) 111
BfaI CTAG 1 cut(s) 236
BisI GCNGC 3 cut(s) 69, 298, 451
BlpI GCTNAGC 1 cut(s) 27
BlsI GCNGC 3 cut(s) 70, 299, 452
Bme1390I CCNGG 1 cut(s) 111
Bme18I GGWCC 2 cut(s) 74, 176
BmeRI GACNNNNNGTC 1 cut(s) 248
BmgT120I GGNCC 2 cut(s) 74, 176
BmiI GGNNCC 1 cut(s) 351
BmrFI CCNGG 1 cut(s) 111
Bpu10I CCTNAGC 1 cut(s) 14
Bpu1102I GCTNAGC 1 cut(s) 27
BpuMI CCSGG 1 cut(s) 111
Bsc4I CCNNNNNNNGG 2 cut(s) 101, 211
Bse118I RCCGGY 1 cut(s) 71
BseLI CCNNNNNNNGG 2 cut(s) 101, 211
BseMII CTCAG 1 cut(s) 28
BseXI GCAGC 2 cut(s) 309, 437
BshFI GGCC 1 cut(s) 204
BsiHKAI GWGCWC 1 cut(s) 211
BsiSI CCGG 2 cut(s) 72, 111
BslI CCNNNNNNNGG 2 cut(s) 101, 211
BsmI GAATGC 1 cut(s) 105
BsnI GGCC 1 cut(s) 204
Bsp1286I GDGCHC 1 cut(s) 211
Bsp143I GATC 2 cut(s) 9, 130
Bsp1720I GCTNAGC 1 cut(s) 27
BspACI CCGC 1 cut(s) 69
BspANI GGCC 1 cut(s) 204
BspCNI CTCAG 1 cut(s) 27
BspLI GGNNCC 1 cut(s) 351
BspPI GGATC 1 cut(s) 4
BsrFI RCCGGY 1 cut(s) 71
BssAI RCCGGY 1 cut(s) 71
BssMI GATC 2 cut(s) 9, 130
Bst4CI ACNGT 3 cut(s) 145, 229, 463
BstC8I GCNNGC 1 cut(s) 103
BstDEI CTNAG 2 cut(s) 14, 27
BstKTI GATC 2 cut(s) 12, 133
BstMBI GATC 2 cut(s) 9, 130
BstMWI GCNNNNNNNGC 1 cut(s) 334
BstSCI CCNGG 1 cut(s) 109
BstV1I GCAGC 2 cut(s) 309, 437
BstX2I RGATCY 1 cut(s) 9
BstYI RGATCY 1 cut(s) 9
BsuRI GGCC 1 cut(s) 204
Cac8I GCNNGC 1 cut(s) 103
Cfr10I RCCGGY 1 cut(s) 71
Cfr13I GGNCC 2 cut(s) 74, 176
Csp6I GTAC 4 cut(s) 52, 289, 342, 366
CviAII CATG 1 cut(s) 49
CviJI RGCY 6 cut(s) 31, 118, 183, 204, 337, 435
CviKI_1 RGCY 6 cut(s) 31, 118, 183, 204, 337, 435
CviQI GTAC 4 cut(s) 52, 289, 342, 366
DdeI CTNAG 2 cut(s) 14, 27
DpnI GATC 2 cut(s) 11, 132
DpnII GATC 2 cut(s) 9, 130
DraI TTTAAA 1 cut(s) 39
DriI GACNNNNNGTC 1 cut(s) 248
EaeI YGGCCR 1 cut(s) 202
Eam1105I GACNNNNNGTC 1 cut(s) 248
Eco47I GGWCC 2 cut(s) 74, 176
FaeI CATG 1 cut(s) 52
FaiI YATR 6 cut(s) 50, 92, 129, 263, 324, 446
FatI CATG 1 cut(s) 48
FbaI TGATCA 1 cut(s) 130
Fnu4HI GCNGC 3 cut(s) 69, 298, 451
Fsp4HI GCNGC 3 cut(s) 69, 298, 451
FspBI CTAG 1 cut(s) 236
GluI GCNGC 3 cut(s) 69, 298, 451
HaeIII GGCC 1 cut(s) 204
HapII CCGG 2 cut(s) 72, 111
Hin1II CATG 1 cut(s) 52
HindIII AAGCTT 2 cut(s) 29, 116
HpaII CCGG 2 cut(s) 72, 111
Hpy166II GTNNAC 2 cut(s) 148, 276
Hpy188I TCNGA 1 cut(s) 193
Hpy8I GTNNAC 2 cut(s) 148, 276
Hpy99I CGWCG 1 cut(s) 161
HpyCH4III ACNGT 3 cut(s) 145, 229, 463
HpyCH4IV ACGT 2 cut(s) 244, 249
HpyCH4V TGCA 5 cut(s) 101, 221, 386, 453, 466
HpyF10VI GCNNNNNNNGC 1 cut(s) 334
HpyF3I CTNAG 2 cut(s) 14, 27
HpySE526I ACGT 2 cut(s) 244, 249
Hsp92II CATG 1 cut(s) 52
Ksp22I TGATCA 1 cut(s) 130
Kzo9I GATC 2 cut(s) 9, 130
LpnPI CCDG 7 cut(s) 85, 87, 124, 197, 348, 354, 366
Lsp1109I GCAGC 2 cut(s) 309, 437
MaeI CTAG 1 cut(s) 236
MaeII ACGT 2 cut(s) 244, 249
MaeIII GTNAC 1 cut(s) 245
MalI GATC 2 cut(s) 11, 132
MboI GATC 2 cut(s) 9, 130
MboII GAAGA 1 cut(s) 409
MfeI CAATTG 1 cut(s) 96
MflI RGATCY 1 cut(s) 9
MhlI GDGCHC 1 cut(s) 211
MluCI AATT 5 cut(s) 34, 96, 134, 187, 329
MnlI CCTC 3 cut(s) 23, 117, 340
MseI TTAA 3 cut(s) 33, 38, 475
MspI CCGG 2 cut(s) 72, 111
MspR9I CCNGG 1 cut(s) 111
MunI CAATTG 1 cut(s) 96
Mva1269I GAATGC 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 334
NciI CCSGG 1 cut(s) 111
NdeII GATC 2 cut(s) 9, 130
NlaIII CATG 1 cut(s) 52
NlaIV GGNNCC 1 cut(s) 351
NmeAIII GCCGAG 2 cut(s) 230, 363
PcsI WCGNNNNNNNCGW 1 cut(s) 246
PctI GAATGC 1 cut(s) 105
PfoI TCCNGGA 1 cut(s) 109
PkrI GCNGC 3 cut(s) 70, 299, 452
PspN4I GGNNCC 1 cut(s) 351
PspPI GGNCC 2 cut(s) 74, 176
PsuI RGATCY 1 cut(s) 9
RsaI GTAC 4 cut(s) 53, 290, 343, 367
RsaNI GTAC 4 cut(s) 52, 289, 342, 366
SaqAI TTAA 3 cut(s) 33, 38, 475
SatI GCNGC 3 cut(s) 69, 298, 451
Sau3AI GATC 2 cut(s) 9, 130
Sau96I GGNCC 2 cut(s) 74, 176
ScrFI CCNGG 1 cut(s) 111
SduI GDGCHC 1 cut(s) 211
SetI ASST 7 cut(s) 33, 120, 128, 247, 252, 351, 367
SinI GGWCC 2 cut(s) 74, 176
Sse9I AATT 5 cut(s) 34, 96, 134, 187, 329
SsiI CCGC 1 cut(s) 69
SspI AATATT 1 cut(s) 457
SspMI CTAG 1 cut(s) 236
StyD4I CCNGG 1 cut(s) 109
TaaI ACNGT 3 cut(s) 145, 229, 463
TaiI ACGT 2 cut(s) 247, 252
TaqI TCGA 2 cut(s) 266, 420
TasI AATT 5 cut(s) 34, 96, 134, 187, 329
TatI WGTACW 3 cut(s) 51, 288, 341
TauI GCSGC 1 cut(s) 71
Tru1I TTAA 3 cut(s) 33, 38, 475
Tru9I TTAA 3 cut(s) 33, 38, 475
TseI GCWGC 2 cut(s) 297, 450
TspGWI ACGGA 2 cut(s) 101, 255
VpaK11BI GGWCC 2 cut(s) 74, 176
XspI CTAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.