Rmu_sc0014404.1_g000006

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014404.1
OG0001118
Physical Location & Seq
Reverse (-)
13410 .. 13895
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014404.1_g000006.1.cds

Sequence Viewer

Length: 486 bp
atgagtgctagtgcacttttagtccaagccagttatgtcaaagaaacccgaatggtcttgtacttccaagacatctcgacaggtccaaatgccacaagcataccaattgcaggcattgccggaaagctttggaccttcactcagtttggaacagtttatgtcactgacgacaccatgaccgaaggtccaagcccaaagtcagccgtagttggccgggcacaaggcgtgtcagtggcagcagcgctagacgggagtaatgcccttgtcttggtatcgcttgtgttcactaataaggagtacaatggcagcactatagagatacaaggaaacagtaagcaattcgagtctgtcagagaggttgcagtggtatcaggtaccgggaaattcaggtttgctagaggatatgctacctttgaatcatacttcgtggatcttccgagtgcctactcaatattacggtgcaatgttacagtgcaacattactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

161

Amino Acids

17.3

Weight (kDa)

6.56

Isoelectric Point (pI)

25.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 374
AccB1I GGYRCC 1 cut(s) 374
AclWI GGATC 1 cut(s) 438
AcoI YGGCCR 1 cut(s) 211
AcsI RAATTY 1 cut(s) 383
AfaI GTAC 3 cut(s) 62, 299, 376
AfeI AGCGCT 1 cut(s) 243
AfiI CCNNNNNNNGG 2 cut(s) 110, 268
AgsI TTSAA 1 cut(s) 416
AhdI GACNNNNNGTC 1 cut(s) 183
AluBI AGCT 1 cut(s) 127
AluI AGCT 1 cut(s) 127
Alw21I GWGCWC 1 cut(s) 16
Alw44I GTGCAC 1 cut(s) 12
AlwI GGATC 1 cut(s) 438
Aor51HI AGCGCT 1 cut(s) 243
AoxI GGCC 1 cut(s) 211
ApaLI GTGCAC 1 cut(s) 12
ApeKI GCWGC 3 cut(s) 236, 239, 306
ApoI RAATTY 1 cut(s) 383
Asp718I GGTACC 1 cut(s) 374
AspLEI GCGC 1 cut(s) 244
AspS9I GGNCC 3 cut(s) 83, 132, 185
AsuC2I CCSGG 2 cut(s) 215, 379
AvaII GGWCC 3 cut(s) 83, 132, 185
BaeGI GKGCMC 2 cut(s) 16, 220
BanI GGYRCC 1 cut(s) 374
Bbv12I GWGCWC 1 cut(s) 16
BbvI GCAGC 3 cut(s) 248, 251, 318
BceAI ACGGC 1 cut(s) 188
BcnI CCSGG 2 cut(s) 215, 379
BfaI CTAG 4 cut(s) 9, 245, 396, 484
BfmI CTRYAG 1 cut(s) 312
BfoI RGCGCY 1 cut(s) 245
BisI GCNGC 3 cut(s) 237, 240, 307
BlsI GCNGC 3 cut(s) 238, 241, 308
Bme1390I CCNGG 2 cut(s) 215, 379
Bme18I GGWCC 3 cut(s) 83, 132, 185
BmeRI GACNNNNNGTC 1 cut(s) 183
BmgT120I GGNCC 3 cut(s) 83, 132, 185
BmiI GGNNCC 1 cut(s) 376
BmrFI CCNGG 2 cut(s) 215, 379
BpuMI CCSGG 2 cut(s) 215, 379
Bsc4I CCNNNNNNNGG 2 cut(s) 110, 268
Bse1I ACTGG 1 cut(s) 30
Bse3DI GCAATG 2 cut(s) 114, 469
BseLI CCNNNNNNNGG 2 cut(s) 110, 268
BseMI GCAATG 2 cut(s) 114, 469
BseMII CTCAG 1 cut(s) 155
BseNI ACTGG 1 cut(s) 30
BseSI GKGCMC 2 cut(s) 16, 220
BseXI GCAGC 3 cut(s) 248, 251, 318
BshFI GGCC 1 cut(s) 213
BshNI GGYRCC 1 cut(s) 374
BsiHKAI GWGCWC 1 cut(s) 16
BsiSI CCGG 3 cut(s) 120, 214, 378
BslI CCNNNNNNNGG 2 cut(s) 110, 268
BsnI GGCC 1 cut(s) 213
Bsp1286I GDGCHC 2 cut(s) 16, 220
Bsp143I GATC 1 cut(s) 430
BspANI GGCC 1 cut(s) 213
BspCNI CTCAG 1 cut(s) 154
BspLI GGNNCC 1 cut(s) 376
BspPI GGATC 1 cut(s) 438
BspT107I GGYRCC 1 cut(s) 374
BsrDI GCAATG 2 cut(s) 114, 469
BsrI ACTGG 1 cut(s) 30
BssMI GATC 1 cut(s) 430
Bst4CI ACNGT 4 cut(s) 154, 332, 459, 472
BstAPI GCANNNNNTGC 1 cut(s) 116
BstC8I GCNNGC 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 141
BstH2I RGCGCY 1 cut(s) 245
BstHHI GCGC 1 cut(s) 244
BstKTI GATC 1 cut(s) 433
BstMBI GATC 1 cut(s) 430
BstMWI GCNNNNNNNGC 1 cut(s) 116
BstSCI CCNGG 2 cut(s) 213, 377
BstSFI CTRYAG 1 cut(s) 312
BstSLI GKGCMC 2 cut(s) 16, 220
BstV1I GCAGC 3 cut(s) 248, 251, 318
BstX2I RGATCY 1 cut(s) 430
BstYI RGATCY 1 cut(s) 430
BsuRI GGCC 1 cut(s) 213
BtsI GCAGTG 1 cut(s) 369
BtsIMutI CAGTG 4 cut(s) 162, 237, 369, 477
Cac8I GCNNGC 1 cut(s) 112
CfoI GCGC 1 cut(s) 244
Cfr13I GGNCC 3 cut(s) 83, 132, 185
Csp6I GTAC 3 cut(s) 61, 298, 375
CviAII CATG 1 cut(s) 175
CviJI RGCY 5 cut(s) 29, 127, 192, 203, 213
CviKI_1 RGCY 5 cut(s) 29, 127, 192, 203, 213
CviQI GTAC 3 cut(s) 61, 298, 375
DdeI CTNAG 1 cut(s) 141
DpnI GATC 1 cut(s) 432
DpnII GATC 1 cut(s) 430
DriI GACNNNNNGTC 1 cut(s) 183
EaeI YGGCCR 1 cut(s) 211
Eam1105I GACNNNNNGTC 1 cut(s) 183
Eco47I GGWCC 3 cut(s) 83, 132, 185
Eco47III AGCGCT 1 cut(s) 243
FaeI CATG 1 cut(s) 178
FaiI YATR 7 cut(s) 36, 101, 159, 176, 314, 405, 421
FatI CATG 1 cut(s) 174
Fnu4HI GCNGC 3 cut(s) 237, 240, 307
Fsp4HI GCNGC 3 cut(s) 237, 240, 307
FspBI CTAG 4 cut(s) 9, 245, 396, 484
GlaI GCGC 1 cut(s) 243
GluI GCNGC 3 cut(s) 237, 240, 307
HaeII RGCGCY 1 cut(s) 245
HaeIII GGCC 1 cut(s) 213
HapII CCGG 3 cut(s) 120, 214, 378
HhaI GCGC 1 cut(s) 244
Hin1II CATG 1 cut(s) 178
Hin6I GCGC 1 cut(s) 242
HinP1I GCGC 1 cut(s) 242
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 2 cut(s) 344, 416
HpaII CCGG 3 cut(s) 120, 214, 378
Hpy166II GTNNAC 2 cut(s) 14, 285
Hpy188I TCNGA 2 cut(s) 353, 438
Hpy188III TCNNGA 1 cut(s) 76
Hpy8I GTNNAC 2 cut(s) 14, 285
HpyAV CCTTC 2 cut(s) 145, 176
HpyCH4III ACNGT 4 cut(s) 154, 332, 459, 472
HpyCH4V TGCA 5 cut(s) 14, 110, 362, 462, 475
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
HpyF3I CTNAG 1 cut(s) 141
Hsp92II CATG 1 cut(s) 178
HspAI GCGC 1 cut(s) 242
KpnI GGTACC 1 cut(s) 378
Kzo9I GATC 1 cut(s) 430
LpnPI CCDG 8 cut(s) 43, 66, 96, 133, 227, 357, 373, 391
Lsp1109I GCAGC 3 cut(s) 248, 251, 318
MaeI CTAG 4 cut(s) 9, 245, 396, 484
MaeIII GTNAC 2 cut(s) 160, 466
MalI GATC 1 cut(s) 432
MboI GATC 1 cut(s) 430
MboII GAAGA 1 cut(s) 425
MfeI CAATTG 1 cut(s) 105
MflI RGATCY 1 cut(s) 430
MhlI GDGCHC 2 cut(s) 16, 220
MluCI AATT 3 cut(s) 105, 338, 383
MlyI GAGTC 1 cut(s) 353
MnlI CCTC 2 cut(s) 349, 392
MspI CCGG 3 cut(s) 120, 214, 378
MspR9I CCNGG 2 cut(s) 215, 379
MunI CAATTG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 116
NciI CCSGG 2 cut(s) 215, 379
NdeII GATC 1 cut(s) 430
NlaIII CATG 1 cut(s) 178
NlaIV GGNNCC 1 cut(s) 376
NmuCI GTSAC 1 cut(s) 160
PfeI GAWTC 1 cut(s) 416
PkrI GCNGC 3 cut(s) 238, 241, 308
PleI GAGTC 1 cut(s) 352
PpsI GAGTC 1 cut(s) 352
PspN4I GGNNCC 1 cut(s) 376
PspPI GGNCC 3 cut(s) 83, 132, 185
PsuI RGATCY 1 cut(s) 430
RsaI GTAC 3 cut(s) 62, 299, 376
RsaNI GTAC 3 cut(s) 61, 298, 375
SatI GCNGC 3 cut(s) 237, 240, 307
Sau3AI GATC 1 cut(s) 430
Sau96I GGNCC 3 cut(s) 83, 132, 185
SchI GAGTC 1 cut(s) 353
ScrFI CCNGG 2 cut(s) 215, 379
SduI GDGCHC 2 cut(s) 16, 220
SetI ASST 8 cut(s) 85, 129, 137, 187, 360, 376, 392, 413
SfcI CTRYAG 1 cut(s) 312
SinI GGWCC 3 cut(s) 83, 132, 185
Sse9I AATT 3 cut(s) 105, 338, 383
SspI AATATT 1 cut(s) 453
SspMI CTAG 4 cut(s) 9, 245, 396, 484
StyD4I CCNGG 2 cut(s) 213, 377
TaaI ACNGT 4 cut(s) 154, 332, 459, 472
TaqI TCGA 2 cut(s) 77, 342
TaqII GACCGA 1 cut(s) 194
TasI AATT 3 cut(s) 105, 338, 383
TatI WGTACW 2 cut(s) 60, 297
TfiI GAWTC 1 cut(s) 416
TscAI CASTG 4 cut(s) 169, 237, 369, 477
TseFI GTSAC 1 cut(s) 160
TseI GCWGC 3 cut(s) 236, 239, 306
Tsp45I GTSAC 1 cut(s) 160
TspRI CASTG 4 cut(s) 169, 237, 369, 477
VneI GTGCAC 1 cut(s) 12
VpaK11BI GGWCC 3 cut(s) 83, 132, 185
XapI RAATTY 1 cut(s) 383
XspI CTAG 4 cut(s) 9, 245, 396, 484
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.