Rmu_sc0014404.1_g000009

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014404.1
OG0001118
Physical Location & Seq
Reverse (-)
28516 .. 29064
549 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014404.1_g000009.1.cds

Sequence Viewer

Length: 549 bp
atggcattacagttcaattatcattccctactattggtcgtggttctggccacgactacattcttagacatagccactagcagtatagagttgaaagaaaccaagctatccttgtatttccaggatttctctgccggtccaaatacctcagcagtaccaattgcaggtattgcaggcaagctatggagggtcgatcagtttggaacagttatcgtcacggatgaccggctaactgtagccccgagtccgaaatcagcaacggtgggccgaggccaaggcttggttgtaacatcatcactagatggacgcaatgcccatgtcttgttatcgattgtgttcaccaacaggaggtacaatggcagcactctagagatacaaggaactagtaggcaattcgaggcggttagagaggtttcggtcgtatcaggcaccgggaagtttcggtttgctagaggatatgctacattcgaaacttattctgtggaccctacaaatttatacgcagttatacgattcaatattactgtgcaacacaagttggtgaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

182

Amino Acids

19.91

Weight (kDa)

9.64

Isoelectric Point (pI)

23.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 155
AccB1I GGYRCC 1 cut(s) 428
AccB7I CCANNNNNTGG 1 cut(s) 280
AciI CCGC 1 cut(s) 401
AcoI YGGCCR 1 cut(s) 48
AcsI RAATTY 1 cut(s) 493
AfaI GTAC 2 cut(s) 156, 353
AfiI CCNNNNNNNGG 4 cut(s) 34, 164, 280, 348
AgsI TTSAA 3 cut(s) 16, 94, 517
AhlI ACTAGT 1 cut(s) 383
AjnI CCWGG 1 cut(s) 120
AluBI AGCT 2 cut(s) 106, 181
AluI AGCT 2 cut(s) 106, 181
Ama87I CYCGRG 1 cut(s) 241
AoxI GGCC 3 cut(s) 48, 265, 271
ApeKI GCWGC 1 cut(s) 360
ApoI RAATTY 1 cut(s) 493
AspS9I GGNCC 3 cut(s) 137, 265, 484
AsuC2I CCSGG 1 cut(s) 433
AsuHPI GGTGA 1 cut(s) 331
AsuII TTCGAA 1 cut(s) 468
AvaI CYCGRG 1 cut(s) 241
AvaII GGWCC 2 cut(s) 137, 484
BalI TGGCCA 1 cut(s) 50
BanI GGYRCC 1 cut(s) 428
BbvCI CCTCAGC 1 cut(s) 148
BbvI GCAGC 1 cut(s) 372
BccI CCATC 1 cut(s) 296
BciT130I CCWGG 1 cut(s) 122
BcnI CCSGG 1 cut(s) 433
BcuI ACTAGT 1 cut(s) 383
BfaI CTAG 5 cut(s) 78, 299, 368, 384, 450
BfmI CTRYAG 1 cut(s) 234
BfuAI ACCTGC 1 cut(s) 155
BisI GCNGC 1 cut(s) 361
BlsI GCNGC 1 cut(s) 362
Bme1390I CCNGG 2 cut(s) 122, 433
Bme18I GGWCC 2 cut(s) 137, 484
BmeT110I CYCGRG 1 cut(s) 241
BmgT120I GGNCC 3 cut(s) 137, 265, 484
BmiI GGNNCC 2 cut(s) 430, 486
BmrFI CCNGG 2 cut(s) 122, 433
Bpu10I CCTNAGC 1 cut(s) 148
Bpu14I TTCGAA 1 cut(s) 468
BpuMI CCSGG 1 cut(s) 433
Bsa29I ATCGAT 1 cut(s) 329
BsaJI CCNNGG 2 cut(s) 268, 274
Bsc4I CCNNNNNNNGG 4 cut(s) 34, 164, 280, 348
Bse118I RCCGGY 2 cut(s) 134, 225
Bse3DI GCAATG 1 cut(s) 316
BseBI CCWGG 1 cut(s) 122
BseCI ATCGAT 1 cut(s) 329
BseDI CCNNGG 2 cut(s) 268, 274
BseGI GGATG 1 cut(s) 226
BseLI CCNNNNNNNGG 4 cut(s) 34, 164, 280, 348
BseMI GCAATG 1 cut(s) 316
BseMII CTCAG 1 cut(s) 162
BseXI GCAGC 1 cut(s) 372
Bsh1285I CGRYCG 1 cut(s) 420
BshFI GGCC 3 cut(s) 50, 267, 273
BshNI GGYRCC 1 cut(s) 428
BshVI ATCGAT 1 cut(s) 329
BsiEI CGRYCG 1 cut(s) 420
BsiHKCI CYCGRG 1 cut(s) 241
BsiSI CCGG 3 cut(s) 135, 226, 432
BslI CCNNNNNNNGG 4 cut(s) 34, 164, 280, 348
BsnI GGCC 3 cut(s) 50, 267, 273
BsoBI CYCGRG 1 cut(s) 241
Bsp119I TTCGAA 1 cut(s) 468
Bsp143I GATC 1 cut(s) 193
BspACI CCGC 1 cut(s) 401
BspANI GGCC 3 cut(s) 50, 267, 273
BspCNI CTCAG 1 cut(s) 161
BspDI ATCGAT 1 cut(s) 329
BspLI GGNNCC 2 cut(s) 430, 486
BspMI ACCTGC 1 cut(s) 155
BspT104I TTCGAA 1 cut(s) 468
BspT107I GGYRCC 1 cut(s) 428
BsrDI GCAATG 1 cut(s) 316
BsrFI RCCGGY 2 cut(s) 134, 225
BssAI RCCGGY 2 cut(s) 134, 225
BssECI CCNNGG 2 cut(s) 268, 274
BssMI GATC 1 cut(s) 193
BssT1I CCWWGG 1 cut(s) 274
Bst2UI CCWGG 1 cut(s) 122
Bst4CI ACNGT 5 cut(s) 12, 208, 235, 262, 526
BstAPI GCANNNNNTGC 1 cut(s) 170
BstBI TTCGAA 1 cut(s) 468
BstC8I GCNNGC 2 cut(s) 175, 179
BstDEI CTNAG 2 cut(s) 64, 148
BstF5I GGATG 1 cut(s) 226
BstKTI GATC 1 cut(s) 196
BstMBI GATC 1 cut(s) 193
BstMCI CGRYCG 1 cut(s) 420
BstMWI GCNNNNNNNGC 1 cut(s) 170
BstNI CCWGG 1 cut(s) 122
BstSCI CCNGG 2 cut(s) 120, 431
BstSFI CTRYAG 1 cut(s) 234
BstV1I GCAGC 1 cut(s) 372
Bsu15I ATCGAT 1 cut(s) 329
BsuRI GGCC 3 cut(s) 50, 267, 273
BsuTUI ATCGAT 1 cut(s) 329
BtsCI GGATG 1 cut(s) 226
BveI ACCTGC 1 cut(s) 155
Cac8I GCNNGC 2 cut(s) 175, 179
Cfr10I RCCGGY 2 cut(s) 134, 225
Cfr13I GGNCC 3 cut(s) 137, 265, 484
ClaI ATCGAT 1 cut(s) 329
CseI GACGC 1 cut(s) 315
Csp6I GTAC 2 cut(s) 155, 352
CviAII CATG 1 cut(s) 317
CviJI RGCY 9 cut(s) 50, 74, 106, 181, 229, 239, 267, 273, 279
CviKI_1 RGCY 9 cut(s) 50, 74, 106, 181, 229, 239, 267, 273, 279
CviQI GTAC 2 cut(s) 155, 352
DdeI CTNAG 2 cut(s) 64, 148
DpnI GATC 1 cut(s) 195
DpnII GATC 1 cut(s) 193
EaeI YGGCCR 1 cut(s) 48
Eco130I CCWWGG 1 cut(s) 274
Eco47I GGWCC 2 cut(s) 137, 484
Eco88I CYCGRG 1 cut(s) 241
EcoRII CCWGG 1 cut(s) 120
EcoT14I CCWWGG 1 cut(s) 274
ErhI CCWWGG 1 cut(s) 274
FaeI CATG 1 cut(s) 320
FaiI YATR 7 cut(s) 71, 86, 184, 318, 459, 499, 509
FalI AAGNNNNNCTT 2 cut(s) 95, 127
FatI CATG 1 cut(s) 316
Fnu4HI GCNGC 1 cut(s) 361
FokI GGATG 1 cut(s) 233
Fsp4HI GCNGC 1 cut(s) 361
FspBI CTAG 5 cut(s) 78, 299, 368, 384, 450
GluI GCNGC 1 cut(s) 361
HaeIII GGCC 3 cut(s) 50, 267, 273
HapII CCGG 3 cut(s) 135, 226, 432
HgaI GACGC 1 cut(s) 315
Hin1II CATG 1 cut(s) 320
HinfI GANTC 2 cut(s) 244, 513
HpaII CCGG 3 cut(s) 135, 226, 432
HphI GGTGA 1 cut(s) 331
Hpy166II GTNNAC 2 cut(s) 339, 484
Hpy188I TCNGA 1 cut(s) 249
Hpy188III TCNNGA 1 cut(s) 368
Hpy8I GTNNAC 2 cut(s) 339, 484
HpyCH4III ACNGT 5 cut(s) 12, 208, 235, 262, 526
HpyCH4V TGCA 3 cut(s) 164, 173, 529
HpyF10VI GCNNNNNNNGC 1 cut(s) 170
HpyF3I CTNAG 2 cut(s) 64, 148
Hsp92II CATG 1 cut(s) 320
Kzo9I GATC 1 cut(s) 193
Lsp1109I GCAGC 1 cut(s) 372
MaeI CTAG 5 cut(s) 78, 299, 368, 384, 450
MaeIII GTNAC 2 cut(s) 214, 286
MalI GATC 1 cut(s) 195
MboI GATC 1 cut(s) 193
MfeI CAATTG 1 cut(s) 159
MlsI TGGCCA 1 cut(s) 50
MluCI AATT 4 cut(s) 16, 159, 392, 493
MluNI TGGCCA 1 cut(s) 50
MlyI GAGTC 1 cut(s) 253
MnlI CCTC 7 cut(s) 157, 180, 263, 342, 391, 403, 446
Mox20I TGGCCA 1 cut(s) 50
MscI TGGCCA 1 cut(s) 50
Msp20I TGGCCA 1 cut(s) 50
MspI CCGG 3 cut(s) 135, 226, 432
MspR9I CCNGG 2 cut(s) 122, 433
MunI CAATTG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 170
NciI CCSGG 1 cut(s) 433
NdeII GATC 1 cut(s) 193
NlaIII CATG 1 cut(s) 320
NlaIV GGNNCC 2 cut(s) 430, 486
NmeAIII GCCGAG 1 cut(s) 293
NmuCI GTSAC 1 cut(s) 214
NspV TTCGAA 1 cut(s) 468
PfeI GAWTC 1 cut(s) 513
PflMI CCANNNNNTGG 1 cut(s) 280
PfoI TCCNGGA 1 cut(s) 120
PkrI GCNGC 1 cut(s) 362
PleI GAGTC 1 cut(s) 252
PpsI GAGTC 1 cut(s) 252
Psp6I CCWGG 1 cut(s) 120
PspGI CCWGG 1 cut(s) 120
PspN4I GGNNCC 2 cut(s) 430, 486
PspPI GGNCC 3 cut(s) 137, 265, 484
RsaI GTAC 2 cut(s) 156, 353
RsaNI GTAC 2 cut(s) 155, 352
SatI GCNGC 1 cut(s) 361
Sau3AI GATC 1 cut(s) 193
Sau96I GGNCC 3 cut(s) 137, 265, 484
SchI GAGTC 1 cut(s) 253
ScrFI CCNGG 2 cut(s) 122, 433
SetI ASST 6 cut(s) 108, 149, 169, 183, 353, 414
SfcI CTRYAG 1 cut(s) 234
SfuI TTCGAA 1 cut(s) 468
SinI GGWCC 2 cut(s) 137, 484
SpeI ACTAGT 1 cut(s) 383
Sse9I AATT 4 cut(s) 16, 159, 392, 493
SsiI CCGC 1 cut(s) 401
SspI AATATT 1 cut(s) 520
SspMI CTAG 5 cut(s) 78, 299, 368, 384, 450
StyD4I CCNGG 2 cut(s) 120, 431
StyI CCWWGG 1 cut(s) 274
TaaI ACNGT 5 cut(s) 12, 208, 235, 262, 526
TaqI TCGA 4 cut(s) 192, 329, 396, 468
TaqII GACCGA 1 cut(s) 406
TasI AATT 4 cut(s) 16, 159, 392, 493
TfiI GAWTC 1 cut(s) 513
TseFI GTSAC 1 cut(s) 214
TseI GCWGC 1 cut(s) 360
Tsp45I GTSAC 1 cut(s) 214
TspGWI ACGGA 1 cut(s) 233
Van91I CCANNNNNTGG 1 cut(s) 280
VpaK11BI GGWCC 2 cut(s) 137, 484
XapI RAATTY 1 cut(s) 493
XbaI TCTAGA 1 cut(s) 367
XspI CTAG 5 cut(s) 78, 299, 368, 384, 450
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.