Rh2BG547600

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
75700568 .. 75701035
468 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG547600.1

Sequence Viewer

Length: 468 bp
ATGGCCGGCACTCATGAGTTCAAAGAAACCCAAATGTCCCTGTACTTCCAGGACTTCACCACCGGGCCAAATCTCACGACATTACCAATTGCAGGAATTGCCGGCAAGTTTTGGACCTTTGATCAATTTGGAACAGTTTATGTCACCGACGACCCCATAACCGAAGGCCCAAGCCCTAAATCTGCACCAGTTGGCCGAGGACAGGCTTTTATTGTAACATCAGCACTAGATGGACGTAACGCCCTAGTTTTTCTCTCGATTGTGTTCACAAACAAGAAGTACAACGGTAGCACTATTGAGATACAAGGAAACAGTAAGCAATTTGAGCCGGTAACAGAGGTGGCCGTGGTTTCAGGTACTGGTAAATTTCGATTTGCTAGGGGATATGCTACGCTCGAAACTTATTTCGTGGACCAACCAAGGGGCTACTCTGTTATACGCTGCAATGCTACAGTGCAACACTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

155

Amino Acids

17.04

Weight (kDa)

6.72

Isoelectric Point (pI)

23.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 10 - 152 1e-43 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 3 cut(s) 3, 193, 342
AcsI RAATTY 1 cut(s) 365
AfaI GTAC 3 cut(s) 44, 281, 358
AfiI CCNNNNNNNGG 3 cut(s) 92, 202, 421
AgsI TTSAA 1 cut(s) 22
AjnI CCWGG 1 cut(s) 48
AlwNI CAGNNNCTG 1 cut(s) 359
AoxI GGCC 5 cut(s) 3, 65, 166, 193, 342
ApeKI GCWGC 1 cut(s) 441
ApoI RAATTY 1 cut(s) 365
AspS9I GGNCC 4 cut(s) 65, 114, 167, 412
AsuC2I CCSGG 1 cut(s) 64
AsuHPI GGTGA 2 cut(s) 49, 136
AvaII GGWCC 2 cut(s) 114, 412
BbvI GCAGC 1 cut(s) 428
BccI CCATC 1 cut(s) 224
BceAI ACGGC 1 cut(s) 329
BciT130I CCWGG 1 cut(s) 50
BclI TGATCA 1 cut(s) 121
BcnI CCSGG 1 cut(s) 64
BfaI CTAG 3 cut(s) 227, 245, 378
BfmI CTRYAG 1 cut(s) 450
BisI GCNGC 1 cut(s) 442
BlsI GCNGC 1 cut(s) 443
Bme1390I CCNGG 2 cut(s) 50, 64
Bme18I GGWCC 2 cut(s) 114, 412
BmgT120I GGNCC 4 cut(s) 65, 114, 167, 412
BmrFI CCNGG 2 cut(s) 50, 64
BpuMI CCSGG 1 cut(s) 64
BsaJI CCNNGG 3 cut(s) 196, 345, 419
Bsc4I CCNNNNNNNGG 3 cut(s) 92, 202, 421
Bse118I RCCGGY 3 cut(s) 5, 101, 328
Bse1I ACTGG 2 cut(s) 188, 364
Bse3DI GCAATG 1 cut(s) 451
BseBI CCWGG 1 cut(s) 50
BseDI CCNNGG 3 cut(s) 196, 345, 419
BseLI CCNNNNNNNGG 3 cut(s) 92, 202, 421
BseMI GCAATG 1 cut(s) 451
BseNI ACTGG 2 cut(s) 188, 364
BseXI GCAGC 1 cut(s) 428
BsgI GTGCAG 1 cut(s) 168
BshFI GGCC 5 cut(s) 5, 67, 168, 195, 344
BsiSI CCGG 4 cut(s) 6, 63, 102, 329
BslFI GGGAC 1 cut(s) 22
BslI CCNNNNNNNGG 3 cut(s) 92, 202, 421
BsmFI GGGAC 1 cut(s) 22
BsnI GGCC 5 cut(s) 5, 67, 168, 195, 344
Bsp143I GATC 1 cut(s) 121
BspANI GGCC 5 cut(s) 5, 67, 168, 195, 344
BspHI TCATGA 1 cut(s) 13
BsrDI GCAATG 1 cut(s) 451
BsrFI RCCGGY 3 cut(s) 5, 101, 328
BsrI ACTGG 2 cut(s) 188, 364
BssAI RCCGGY 3 cut(s) 5, 101, 328
BssECI CCNNGG 3 cut(s) 196, 345, 419
BssMI GATC 1 cut(s) 121
BssT1I CCWWGG 1 cut(s) 419
Bst2UI CCWGG 1 cut(s) 50
Bst4CI ACNGT 4 cut(s) 136, 287, 314, 454
BstAPI GCANNNNNTGC 1 cut(s) 98
BstC8I GCNNGC 2 cut(s) 7, 103
BstDSI CCRYGG 1 cut(s) 345
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstMWI GCNNNNNNNGC 2 cut(s) 98, 325
BstNI CCWGG 1 cut(s) 50
BstSCI CCNGG 2 cut(s) 48, 62
BstSFI CTRYAG 1 cut(s) 450
BstV1I GCAGC 1 cut(s) 428
BsuRI GGCC 5 cut(s) 5, 67, 168, 195, 344
BtgI CCRYGG 1 cut(s) 345
BtsIMutI CAGTG 1 cut(s) 459
Cac8I GCNNGC 2 cut(s) 7, 103
CaiI CAGNNNCTG 1 cut(s) 359
CciI TCATGA 1 cut(s) 13
Cfr10I RCCGGY 3 cut(s) 5, 101, 328
Cfr13I GGNCC 4 cut(s) 65, 114, 167, 412
Csp6I GTAC 3 cut(s) 43, 280, 357
CviAII CATG 1 cut(s) 14
CviJI RGCY 9 cut(s) 5, 67, 168, 174, 195, 206, 328, 344, 426
CviKI_1 RGCY 9 cut(s) 5, 67, 168, 174, 195, 206, 328, 344, 426
CviQI GTAC 3 cut(s) 43, 280, 357
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
EaeI YGGCCR 3 cut(s) 3, 193, 342
Eco130I CCWWGG 1 cut(s) 419
Eco47I GGWCC 2 cut(s) 114, 412
EcoRII CCWGG 1 cut(s) 48
EcoT14I CCWWGG 1 cut(s) 419
ErhI CCWWGG 1 cut(s) 419
FaeI CATG 1 cut(s) 17
FaiI YATR 5 cut(s) 15, 141, 158, 387, 437
FaqI GGGAC 1 cut(s) 22
FatI CATG 1 cut(s) 13
FbaI TGATCA 1 cut(s) 121
Fnu4HI GCNGC 1 cut(s) 442
Fsp4HI GCNGC 1 cut(s) 442
FspBI CTAG 3 cut(s) 227, 245, 378
GluI GCNGC 1 cut(s) 442
HaeIII GGCC 5 cut(s) 5, 67, 168, 195, 344
HapII CCGG 4 cut(s) 6, 63, 102, 329
Hin1II CATG 1 cut(s) 17
HpaII CCGG 4 cut(s) 6, 63, 102, 329
HphI GGTGA 2 cut(s) 49, 136
Hpy166II GTNNAC 2 cut(s) 267, 412
Hpy188III TCNNGA 3 cut(s) 14, 76, 256
Hpy8I GTNNAC 2 cut(s) 267, 412
Hpy99I CGWCG 1 cut(s) 152
HpyAV CCTTC 1 cut(s) 158
HpyCH4III ACNGT 4 cut(s) 136, 287, 314, 454
HpyCH4IV ACGT 1 cut(s) 235
HpyCH4V TGCA 4 cut(s) 92, 185, 444, 457
HpyF10VI GCNNNNNNNGC 2 cut(s) 98, 325
HpySE526I ACGT 1 cut(s) 235
Hsp92II CATG 1 cut(s) 17
KroI GCCGGC 2 cut(s) 5, 101
KroNI GCCGGC 2 cut(s) 7, 103
Ksp22I TGATCA 1 cut(s) 121
Kzo9I GATC 1 cut(s) 121
Lsp1109I GCAGC 1 cut(s) 428
MaeI CTAG 3 cut(s) 227, 245, 378
MaeII ACGT 1 cut(s) 235
MaeIII GTNAC 4 cut(s) 142, 214, 236, 331
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MfeI CAATTG 1 cut(s) 87
MluCI AATT 5 cut(s) 87, 96, 125, 320, 365
MnlI CCTC 2 cut(s) 191, 331
MroNI GCCGGC 2 cut(s) 5, 101
MspI CCGG 4 cut(s) 6, 63, 102, 329
MspR9I CCNGG 2 cut(s) 50, 64
MunI CAATTG 1 cut(s) 87
MvaI CCWGG 1 cut(s) 50
MwoI GCNNNNNNNGC 2 cut(s) 98, 325
NaeI GCCGGC 2 cut(s) 7, 103
NciI CCSGG 1 cut(s) 64
NdeII GATC 1 cut(s) 121
NgoMIV GCCGGC 2 cut(s) 5, 101
NlaIII CATG 1 cut(s) 17
NmeAIII GCCGAG 1 cut(s) 221
NmuCI GTSAC 1 cut(s) 142
PagI TCATGA 1 cut(s) 13
PdiI GCCGGC 2 cut(s) 7, 103
PfoI TCCNGGA 1 cut(s) 48
PkrI GCNGC 1 cut(s) 443
Psp6I CCWGG 1 cut(s) 48
PspGI CCWGG 1 cut(s) 48
PspPI GGNCC 4 cut(s) 65, 114, 167, 412
PstNI CAGNNNCTG 1 cut(s) 359
RsaI GTAC 3 cut(s) 44, 281, 358
RsaNI GTAC 3 cut(s) 43, 280, 357
SatI GCNGC 1 cut(s) 442
Sau3AI GATC 1 cut(s) 121
Sau96I GGNCC 4 cut(s) 65, 114, 167, 412
ScrFI CCNGG 2 cut(s) 50, 64
SetI ASST 4 cut(s) 119, 238, 342, 358
SfcI CTRYAG 1 cut(s) 450
SinI GGWCC 2 cut(s) 114, 412
Sse9I AATT 5 cut(s) 87, 96, 125, 320, 365
SspMI CTAG 3 cut(s) 227, 245, 378
StyD4I CCNGG 2 cut(s) 48, 62
StyI CCWWGG 1 cut(s) 419
TaaI ACNGT 4 cut(s) 136, 287, 314, 454
TaiI ACGT 1 cut(s) 238
TaqI TCGA 3 cut(s) 257, 370, 396
TasI AATT 5 cut(s) 87, 96, 125, 320, 365
TatI WGTACW 2 cut(s) 42, 279
TscAI CASTG 1 cut(s) 459
TseFI GTSAC 1 cut(s) 142
TseI GCWGC 1 cut(s) 441
Tsp45I GTSAC 1 cut(s) 142
TspRI CASTG 1 cut(s) 459
VpaK11BI GGWCC 2 cut(s) 114, 412
XapI RAATTY 1 cut(s) 365
XspI CTAG 3 cut(s) 227, 245, 378
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.