MD07G1056500.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0000989
Physical Location & Seq
Reverse (-)
5192764 .. 5195763
3000 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1056500.v1.1.491

Sequence Viewer

Length: 150 bp
ATGGGCGAGGAGAGTTTGATTGCGATGATAAATGGGAAAAGTAGGGACAAATGTGAAGGCATTATTCCTAAGGCCTCTAGAGCAAGCAAGCACCAACTGCTCATGGTTCCAAGATTTGGAGAACCTGATCTCTGCGTCCAGGGTCGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.4

Weight (kDa)

8.8

Isoelectric Point (pI)

19.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 116
AfiI CCNNNNNNNGG 1 cut(s) 116
AjnI CCWGG 1 cut(s) 138
AoxI GGCC 1 cut(s) 72
AxyI CCTNAGG 1 cut(s) 69
BciT130I CCWGG 1 cut(s) 140
BfaI CTAG 1 cut(s) 78
Bme1390I CCNGG 1 cut(s) 140
BmiI GGNNCC 1 cut(s) 108
BmrFI CCNGG 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 139
Bsc4I CCNNNNNNNGG 1 cut(s) 116
Bse21I CCTNAGG 1 cut(s) 69
BseBI CCWGG 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 139
BseLI CCNNNNNNNGG 1 cut(s) 116
BseRI GAGGAG 1 cut(s) 23
BshFI GGCC 1 cut(s) 74
BslFI GGGAC 1 cut(s) 59
BslI CCNNNNNNNGG 1 cut(s) 116
BsmFI GGGAC 1 cut(s) 59
BsnI GGCC 1 cut(s) 74
Bsp143I GATC 1 cut(s) 127
BspANI GGCC 1 cut(s) 74
BspLI GGNNCC 1 cut(s) 108
BssECI CCNNGG 1 cut(s) 139
BssMI GATC 1 cut(s) 127
Bst2UI CCWGG 1 cut(s) 140
BstAPI GCANNNNNTGC 1 cut(s) 97
BstC8I GCNNGC 2 cut(s) 85, 89
BstDEI CTNAG 1 cut(s) 69
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstMWI GCNNNNNNNGC 2 cut(s) 80, 97
BstNI CCWGG 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 138
Bsu36I CCTNAGG 1 cut(s) 69
BsuRI GGCC 1 cut(s) 74
BtgZI GCGATG 1 cut(s) 38
Cac8I GCNNGC 2 cut(s) 85, 89
CseI GACGC 1 cut(s) 124
CviAII CATG 1 cut(s) 103
CviJI RGCY 1 cut(s) 74
CviKI_1 RGCY 1 cut(s) 74
DdeI CTNAG 1 cut(s) 69
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
Eco147I AGGCCT 1 cut(s) 74
Eco81I CCTNAGG 1 cut(s) 69
EcoRII CCWGG 1 cut(s) 138
FaeI CATG 1 cut(s) 106
FaiI YATR 1 cut(s) 104
FaqI GGGAC 1 cut(s) 59
FatI CATG 1 cut(s) 102
FspBI CTAG 1 cut(s) 78
HaeIII GGCC 1 cut(s) 74
HgaI GACGC 1 cut(s) 124
Hin1II CATG 1 cut(s) 106
Hpy188III TCNNGA 1 cut(s) 78
HpyAV CCTTC 1 cut(s) 50
HpyF10VI GCNNNNNNNGC 2 cut(s) 80, 97
HpyF3I CTNAG 1 cut(s) 69
Hsp92II CATG 1 cut(s) 106
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 2 cut(s) 125, 138
MaeI CTAG 1 cut(s) 78
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MnlI CCTC 1 cut(s) 85
MspR9I CCNGG 1 cut(s) 140
MvaI CCWGG 1 cut(s) 140
MwoI GCNNNNNNNGC 2 cut(s) 80, 97
NdeII GATC 1 cut(s) 127
NlaIII CATG 1 cut(s) 106
NlaIV GGNNCC 1 cut(s) 108
PceI AGGCCT 1 cut(s) 74
PflMI CCANNNNNTGG 1 cut(s) 116
Psp6I CCWGG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 138
PspN4I GGNNCC 1 cut(s) 108
Sau3AI GATC 1 cut(s) 127
ScrFI CCNGG 1 cut(s) 140
SetI ASST 1 cut(s) 127
SgeI CNNG 7 cut(s) 19, 90, 96, 100, 115, 123, 137
SseBI AGGCCT 1 cut(s) 74
SspMI CTAG 1 cut(s) 78
StuI AGGCCT 1 cut(s) 74
StyD4I CCNGG 1 cut(s) 138
Van91I CCANNNNNTGG 1 cut(s) 116
XbaI TCTAGA 1 cut(s) 77
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.