Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0035874.1

Orthogroup ID

OG0000989

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 1038

Gene Structure 1037 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0035874.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 650 bp

atggccggagttcgtgtcgtcggtggccggatctacgattccgagaacggaaaaacctgtcaccagtgccggcagaagactagggattttgtggcgtcgtgtaagaatctgaagaagaaggctcgctgcaccattagcttttgtcataaatgcctcttgaacagatatggagagaaggctgaagaggtggagcttttggaggactggaactgccccaaatgtagggggaattgtaattgtagtttctgcaggaagaaacaaggcctcaaacccactggtctacttgttcacacagccaaggaaggtgggttcggttcggtttcggagatgttgactgcgagaggaccggagaattttggtattgagaggaaggttgcggagaaggtggctgtcgatggaaaggagaactctgttgatcaaaagattgaggccagcctgaattcaacacaaaatcctgaggagggacaagtcaagaaaacaaagaggagaggattgaaggaaatccgtaatggcagcagggatgatcctaaagtctccgaggatggcagcagggatgatcctaaagtctccgagaatggcagcagggatgatcctaaagtccccgaggatggcagcagggatgatcctaaagtctccaaggatgttgctgt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DDT WHIM1 zf-4CXXC_R1

Protein Analysis

217

Amino Acids

24.02

Weight (kDa)

8.91

Isoelectric Point (pI)

35.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000989)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G67270 AT1G67780 AT1G67780 AT5G38690 AT5G38690
fragaria_vesca	FvH4_2g09180 FvH4_2g25380 FvH4_4g11170 FvH4_5g33470 FvH4_6g45330 FvH4_6g45330 FvH4_6g45330 FvH4_6g45330 FvH4_6g45330 FvH4_6g45330 FvH4_6g45330 FvH4_6g45330
malus_domestica	MD07G1040400.v1.1 MD07G1056500.v1.1 MD09G1085000.v1.1 MD09G1085100.v1.1 MD09G1085300.v1.1 MD17G1074500.v1.1
prunus_persica	Prupe.3G239500_v2.0.a1 Prupe.3G239500_v2.0.a1
pyrus_communis	pycom07g02810 pycom07g03200 pycom09g01060 pycom09g01070 pycom17g07520 pycom17g07530
rosa_chinensis	RchiOBHm_Chr2g0163111 RchiOBHm_Chr4g0409761 RchiOBHm_Chr7g0218691
rosa_laevigata	RLG00000021021 RLG00000021374 RLG00000026962
rosa_multiflora	Rmu_sc0001275.1_g000034 Rmu_sc0003984.1_g000018 Rmu_sc0010800.1_g000003 Rmu_sc0035873.1_g000001 Rmu_sc0035874.1_g000001
rosa_roxburghii	Rroxscaffold_2G00087540 Rroxscaffold_3G00238670
rosa_rugosa	Rorug01G0363900 Rorug02G0500600 Rorug07G0320500
rosa_samantha	Rh1AG181000 Rh1BG149300 Rh2AG566900 Rh2BG188900 Rh2BG543200 Rh2BG579200 Rh2CG549100 Rh2DG552000 Rh2DG589500 Rh4BG164100 Rh5AG393800 Rh6DG341600 Rh7BG185700
rosa_wichuraiana	Rw1G015030 Rw2G046940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	280
AciI	CCGC	1 cut(s)	377
AclWI	GGATC	5 cut(s)	38, 518, 551, 584, 617
AcoI	YGGCCR	2 cut(s)	3, 25
AcsI	RAATTY	2 cut(s)	352, 439
AcuI	CTGAAG	2 cut(s)	131, 201
AcyI	GRCGYC	1 cut(s)	95
AfiI	CCNNNNNNNGG	3 cut(s)	222, 461, 608
AgsI	TTSAA	3 cut(s)	160, 444, 496
AloI	GAACNNNNNNTCC	2 cut(s)	293, 325
AluBI	AGCT	2 cut(s)	138, 193
AluI	AGCT	2 cut(s)	138, 193
Alw26I	GTCTC	3 cut(s)	538, 571, 637
AlwI	GGATC	5 cut(s)	38, 518, 551, 584, 617
Ama87I	CYCGRG	1 cut(s)	602
AoxI	GGCC	4 cut(s)	3, 25, 262, 429
ApeKI	GCWGC	5 cut(s)	126, 513, 546, 579, 612
ApoI	RAATTY	2 cut(s)	352, 439
AspS9I	GGNCC	1 cut(s)	344
AsuHPI	GGTGA	1 cut(s)	53
AvaI	CYCGRG	1 cut(s)	602
AvaII	GGWCC	1 cut(s)	344
AxyI	CCTNAGG	1 cut(s)	456
BbsI	GAAGAC	1 cut(s)	83
BbvI	GCAGC	5 cut(s)	113, 525, 558, 591, 624
BccI	CCATC	3 cut(s)	389, 536, 602
BclI	TGATCA	1 cut(s)	415
BcoDI	GTCTC	3 cut(s)	538, 571, 637
BfaI	CTAG	1 cut(s)	81
BfmI	CTRYAG	1 cut(s)	247
BisI	GCNGC	5 cut(s)	127, 514, 547, 580, 613
BlsI	GCNGC	5 cut(s)	128, 515, 548, 581, 614
Bme18I	GGWCC	1 cut(s)	344
BmeT110I	CYCGRG	1 cut(s)	602
BmgT120I	GGNCC	1 cut(s)	344
BpiI	GAAGAC	1 cut(s)	83
BsaHI	GRCGYC	1 cut(s)	95
BsaJI	CCNNGG	4 cut(s)	297, 537, 603, 636
BsaWI	WCCGGW	1 cut(s)	346
BsaXI	ACNNNNNCTCC	1 cut(s)	30
Bsc4I	CCNNNNNNNGG	3 cut(s)	222, 461, 608
Bse118I	RCCGGY	1 cut(s)	69
Bse1I	ACTGG	3 cut(s)	64, 209, 280
Bse21I	CCTNAGG	1 cut(s)	456
BseDI	CCNNGG	4 cut(s)	297, 537, 603, 636
BseGI	GGATG	7 cut(s)	526, 547, 559, 592, 613, 625, 646
BseLI	CCNNNNNNNGG	3 cut(s)	222, 461, 608
BseMII	CTCAG	1 cut(s)	447
BseNI	ACTGG	3 cut(s)	64, 209, 280
BseRI	GAGGAG	2 cut(s)	473, 499
BseXI	GCAGC	5 cut(s)	113, 525, 558, 591, 624
BsgI	GTGCAG	1 cut(s)	112
BshFI	GGCC	4 cut(s)	5, 27, 264, 431
BsiHKCI	CYCGRG	1 cut(s)	602
BsiSI	CCGG	4 cut(s)	6, 28, 70, 347
BslFI	GGGAC	2 cut(s)	477, 584
BslI	CCNNNNNNNGG	3 cut(s)	222, 461, 608
BsmAI	GTCTC	3 cut(s)	538, 571, 637
BsmFI	GGGAC	2 cut(s)	477, 584
BsnI	GGCC	4 cut(s)	5, 27, 264, 431
BsoBI	CYCGRG	1 cut(s)	602
Bsp143I	GATC	6 cut(s)	30, 415, 523, 556, 589, 622
BspACI	CCGC	1 cut(s)	377
BspANI	GGCC	4 cut(s)	5, 27, 264, 431
BspCNI	CTCAG	1 cut(s)	448
BspMAI	CTGCAG	1 cut(s)	251
BspPI	GGATC	5 cut(s)	38, 518, 551, 584, 617
BsrFI	RCCGGY	1 cut(s)	69
BsrI	ACTGG	3 cut(s)	64, 209, 280
BssAI	RCCGGY	1 cut(s)	69
BssECI	CCNNGG	4 cut(s)	297, 537, 603, 636
BssMI	GATC	6 cut(s)	30, 415, 523, 556, 589, 622
BssNI	GRCGYC	1 cut(s)	95
BssT1I	CCWWGG	2 cut(s)	297, 636
Bst6I	CTCTTC	1 cut(s)	177
BstACI	GRCGYC	1 cut(s)	95
BstC8I	GCNNGC	3 cut(s)	71, 124, 433
BstDEI	CTNAG	1 cut(s)	456
BstF5I	GGATG	7 cut(s)	526, 547, 559, 592, 613, 625, 646
BstKTI	GATC	6 cut(s)	33, 418, 526, 559, 592, 625
BstMAI	GTCTC	3 cut(s)	538, 571, 637
BstMBI	GATC	6 cut(s)	30, 415, 523, 556, 589, 622
BstMWI	GCNNNNNNNGC	1 cut(s)	135
BstSFI	CTRYAG	1 cut(s)	247
BstV1I	GCAGC	5 cut(s)	113, 525, 558, 591, 624
BstV2I	GAAGAC	1 cut(s)	83
BstX2I	RGATCY	1 cut(s)	30
BstYI	RGATCY	1 cut(s)	30
Bsu36I	CCTNAGG	1 cut(s)	456
BsuRI	GGCC	4 cut(s)	5, 27, 264, 431
BtsCI	GGATG	7 cut(s)	526, 547, 559, 592, 613, 625, 646
BtsIMutI	CAGTG	2 cut(s)	71, 273
Cac8I	GCNNGC	3 cut(s)	71, 124, 433
Cfr10I	RCCGGY	1 cut(s)	69
Cfr13I	GGNCC	1 cut(s)	344
CseI	GACGC	1 cut(s)	84
CspCI	CAANNNNNGTGG	2 cut(s)	286, 321
DdeI	CTNAG	1 cut(s)	456
DpnI	GATC	6 cut(s)	32, 417, 525, 558, 591, 624
DpnII	GATC	6 cut(s)	30, 415, 523, 556, 589, 622
EaeI	YGGCCR	2 cut(s)	3, 25
Eam1104I	CTCTTC	1 cut(s)	177
EarI	CTCTTC	1 cut(s)	177
Eco130I	CCWWGG	2 cut(s)	297, 636
Eco147I	AGGCCT	1 cut(s)	264
Eco47I	GGWCC	1 cut(s)	344
Eco57I	CTGAAG	2 cut(s)	131, 201
Eco81I	CCTNAGG	1 cut(s)	456
Eco88I	CYCGRG	1 cut(s)	602
EcoRI	GAATTC	1 cut(s)	439
EcoT14I	CCWWGG	2 cut(s)	297, 636
ErhI	CCWWGG	2 cut(s)	297, 636
FaiI	YATR	2 cut(s)	147, 168
FaqI	GGGAC	2 cut(s)	477, 584
FbaI	TGATCA	1 cut(s)	415
FblI	GTMKAC	1 cut(s)	280
Fnu4HI	GCNGC	5 cut(s)	127, 514, 547, 580, 613
FokI	GGATG	6 cut(s)	533, 554, 566, 599, 620, 632
Fsp4HI	GCNGC	5 cut(s)	127, 514, 547, 580, 613
FspBI	CTAG	1 cut(s)	81
GluI	GCNGC	5 cut(s)	127, 514, 547, 580, 613
HaeIII	GGCC	4 cut(s)	5, 27, 264, 431
HapII	CCGG	4 cut(s)	6, 28, 70, 347
HgaI	GACGC	1 cut(s)	84
Hin1I	GRCGYC	1 cut(s)	95
HincII	GTYRAC	1 cut(s)	333
HindII	GTYRAC	1 cut(s)	333
HinfI	GANTC	2 cut(s)	38, 106
HpaII	CCGG	4 cut(s)	6, 28, 70, 347
HphI	GGTGA	1 cut(s)	53
Hpy166II	GTNNAC	3 cut(s)	281, 289, 333
Hpy188I	TCNGA	5 cut(s)	43, 111, 325, 538, 571
Hpy188III	TCNNGA	3 cut(s)	157, 455, 472
Hpy8I	GTNNAC	3 cut(s)	281, 289, 333
Hpy99I	CGWCG	2 cut(s)	23, 100
HpyAV	CCTTC	6 cut(s)	112, 169, 296, 364, 376, 490
HpyCH4V	TGCA	2 cut(s)	129, 249
HpyF10VI	GCNNNNNNNGC	1 cut(s)	135
HpyF3I	CTNAG	1 cut(s)	456
Hsp92I	GRCGYC	1 cut(s)	95
KroI	GCCGGC	1 cut(s)	69
KroNI	GCCGGC	1 cut(s)	71
Ksp22I	TGATCA	1 cut(s)	415
Kzo9I	GATC	6 cut(s)	30, 415, 523, 556, 589, 622
LmnI	GCTCC	1 cut(s)	190
Lsp1109I	GCAGC	5 cut(s)	113, 525, 558, 591, 624
MaeI	CTAG	1 cut(s)	81
MaeIII	GTNAC	1 cut(s)	59
MalI	GATC	6 cut(s)	32, 417, 525, 558, 591, 624
MboI	GATC	6 cut(s)	30, 415, 523, 556, 589, 622
MboII	GAAGA	5 cut(s)	88, 124, 127, 194, 265
MflI	RGATCY	1 cut(s)	30
MluCI	AATT	4 cut(s)	229, 235, 352, 439
MroNI	GCCGGC	1 cut(s)	69
MspI	CCGG	4 cut(s)	6, 28, 70, 347
MwoI	GCNNNNNNNGC	1 cut(s)	135
NaeI	GCCGGC	1 cut(s)	71
NdeII	GATC	6 cut(s)	30, 415, 523, 556, 589, 622
NgoMIV	GCCGGC	1 cut(s)	69
NmuCI	GTSAC	1 cut(s)	59
PceI	AGGCCT	1 cut(s)	264
PdiI	GCCGGC	1 cut(s)	71
PfeI	GAWTC	2 cut(s)	38, 106
PkrI	GCNGC	5 cut(s)	128, 515, 548, 581, 614
PspPI	GGNCC	1 cut(s)	344
PstI	CTGCAG	1 cut(s)	251
PsuI	RGATCY	1 cut(s)	30
SatI	GCNGC	5 cut(s)	127, 514, 547, 580, 613
Sau3AI	GATC	6 cut(s)	30, 415, 523, 556, 589, 622
Sau96I	GGNCC	1 cut(s)	344
SetI	ASST	7 cut(s)	59, 140, 189, 195, 307, 375, 387
SfcI	CTRYAG	1 cut(s)	247
SinI	GGWCC	1 cut(s)	344
Sse9I	AATT	4 cut(s)	229, 235, 352, 439
SseBI	AGGCCT	1 cut(s)	264
SsiI	CCGC	1 cut(s)	377
SspMI	CTAG	1 cut(s)	81
StuI	AGGCCT	1 cut(s)	264
StyI	CCWWGG	2 cut(s)	297, 636
TaqI	TCGA	1 cut(s)	393
TasI	AATT	4 cut(s)	229, 235, 352, 439
TfiI	GAWTC	2 cut(s)	38, 106
TscAI	CASTG	2 cut(s)	71, 280
TseFI	GTSAC	1 cut(s)	59
TseI	GCWGC	5 cut(s)	126, 513, 546, 579, 612
Tsp45I	GTSAC	1 cut(s)	59
TspGWI	ACGGA	2 cut(s)	63, 494
TspRI	CASTG	2 cut(s)	71, 280
VpaK11BI	GGWCC	1 cut(s)	344
XapI	RAATTY	2 cut(s)	352, 439
XmiI	GTMKAC	1 cut(s)	280
XspI	CTAG	1 cut(s)	81

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.