MD09G1085000.v1.1

WSTF, HB1, Itc1p, MBD9 motif 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0000989
Physical Location & Seq
Reverse (-)
6085296 .. 6085760
465 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1085000.v1.1.491

Sequence Viewer

Length: 183 bp
ATGTTACCGGAAACCAATGAAATATGGGAGGCTGTTAGAATACAGCCTTATGTTGTGGATGCTGATGGCCATGCCTTATGGAAACTGAAAGGCGATTTTGGCGAAGATATATTGCTTCAAGATATGGGAACATGGGATGGAGCTCCTTCTGTTGAAAACAGGTTCTTTATGGTGCTGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDT WHIM1 zf-4CXXC_R1

Protein Analysis

61

Amino Acids

6.89

Weight (kDa)

4.33

Isoelectric Point (pI)

27.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 67
AgsI TTSAA 2 cut(s) 119, 155
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
Alw21I GWGCWC 1 cut(s) 145
AoxI GGCC 1 cut(s) 67
BalI TGGCCA 1 cut(s) 69
BanII GRGCYC 1 cut(s) 145
Bbv12I GWGCWC 1 cut(s) 145
BccI CCATC 2 cut(s) 59, 131
BmsI GCATC 1 cut(s) 49
BsaWI WCCGGW 1 cut(s) 7
BseGI GGATG 2 cut(s) 64, 142
BshFI GGCC 1 cut(s) 69
BsiHKAI GWGCWC 1 cut(s) 145
BsiSI CCGG 1 cut(s) 8
BsnI GGCC 1 cut(s) 69
Bsp1286I GDGCHC 1 cut(s) 145
BspANI GGCC 1 cut(s) 69
BstF5I GGATG 2 cut(s) 64, 142
BstMWI GCNNNNNNNGC 1 cut(s) 99
BsuRI GGCC 1 cut(s) 69
BtsCI GGATG 2 cut(s) 64, 142
CviAII CATG 2 cut(s) 71, 132
CviJI RGCY 4 cut(s) 32, 46, 69, 143
CviKI_1 RGCY 4 cut(s) 32, 46, 69, 143
EaeI YGGCCR 1 cut(s) 67
Ecl136II GAGCTC 1 cut(s) 143
Eco24I GRGCYC 1 cut(s) 145
Eco53kI GAGCTC 1 cut(s) 143
EcoICRI GAGCTC 1 cut(s) 143
EcoT38I GRGCYC 1 cut(s) 145
FaeI CATG 2 cut(s) 74, 135
FaiI YATR 8 cut(s) 25, 51, 72, 79, 110, 125, 133, 170
FatI CATG 2 cut(s) 70, 131
FokI GGATG 2 cut(s) 71, 149
FriOI GRGCYC 1 cut(s) 145
HaeIII GGCC 1 cut(s) 69
HapII CCGG 1 cut(s) 8
Hin1II CATG 2 cut(s) 74, 135
HpaII CCGG 1 cut(s) 8
Hpy188III TCNNGA 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 156
HpyF10VI GCNNNNNNNGC 1 cut(s) 99
Hsp92II CATG 2 cut(s) 74, 135
LmnI GCTCC 2 cut(s) 140, 148
LpnPI CCDG 2 cut(s) 21, 145
LweI GCATC 1 cut(s) 49
MaeIII GTNAC 1 cut(s) 3
MboII GAAGA 1 cut(s) 116
MhlI GDGCHC 1 cut(s) 145
MlsI TGGCCA 1 cut(s) 69
MluNI TGGCCA 1 cut(s) 69
MnlI CCTC 1 cut(s) 22
Mox20I TGGCCA 1 cut(s) 69
MscI TGGCCA 1 cut(s) 69
Msp20I TGGCCA 1 cut(s) 69
MspI CCGG 1 cut(s) 8
MwoI GCNNNNNNNGC 1 cut(s) 99
NlaIII CATG 2 cut(s) 74, 135
Psp124BI GAGCTC 1 cut(s) 145
SacI GAGCTC 1 cut(s) 145
SduI GDGCHC 1 cut(s) 145
SetI ASST 2 cut(s) 145, 164
SfaNI GCATC 1 cut(s) 49
SgeI CNNG 5 cut(s) 20, 83, 131, 144, 172
SstI GAGCTC 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.