MD08G1213300.v1.1

Belongs to the RuvB family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Forward (+)
27654083 .. 27654349
267 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1213300.v1.1.491

Sequence Viewer

Length: 267 bp
ATGGCTTCGATATTAGTTGTTGCTACCAACAGAACTACCACCAGAGGCACAAATTATAGATCCCCACGCGGAATCCCTGTTGATCTCCTTGATCGCCTGCGTATTGTTACCACCCATCCTTATACAGAGGATGAAATCCATAAGATTTTGGACACCAGATGCCAAGAAGTTGAAATGTCGGAAGAGGCAAGGCATTTGTTGACCAAGATTGGTGTTGATGCATCCTTGAGATATGCTATCCATCTCATAACAGCTTCTGCGTTATAA

Protein Analysis

89

Amino Acids

9.93

Weight (kDa)

6.9

Isoelectric Point (pI)

39.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TIP49 PF06068 1 - 43 1.3e-10 TIP49 P-loop domain
TIP49_C PF17856 49 - 87 9e-11 TIP49 AAA-lid domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 265
AccII CGCG 1 cut(s) 69
AciI CCGC 1 cut(s) 69
AclWI GGATC 1 cut(s) 54
AgsI TTSAA 1 cut(s) 173
AluBI AGCT 1 cut(s) 254
AluI AGCT 1 cut(s) 254
AlwI GGATC 1 cut(s) 54
AlwNI CAGNNNCTG 1 cut(s) 257
BccI CCATC 2 cut(s) 123, 249
BmsI GCATC 3 cut(s) 149, 208, 230
BpuEI CTTGAG 1 cut(s) 247
BseGI GGATG 3 cut(s) 115, 136, 221
Bsh1236I CGCG 1 cut(s) 69
Bsp143I GATC 3 cut(s) 59, 82, 91
BspACI CCGC 1 cut(s) 69
BspFNI CGCG 1 cut(s) 69
BspPI GGATC 1 cut(s) 54
BssMI GATC 3 cut(s) 59, 82, 91
Bst6I CTCTTC 1 cut(s) 177
BstC8I GCNNGC 1 cut(s) 98
BstF5I GGATG 3 cut(s) 115, 136, 221
BstFNI CGCG 1 cut(s) 69
BstKTI GATC 3 cut(s) 62, 85, 94
BstMBI GATC 3 cut(s) 59, 82, 91
BstUI CGCG 1 cut(s) 69
BstX2I RGATCY 1 cut(s) 59
BstYI RGATCY 1 cut(s) 59
BtsCI GGATG 3 cut(s) 115, 136, 221
Cac8I GCNNGC 1 cut(s) 98
CaiI CAGNNNCTG 1 cut(s) 257
CviJI RGCY 2 cut(s) 5, 254
CviKI_1 RGCY 2 cut(s) 5, 254
DpnI GATC 3 cut(s) 61, 84, 93
DpnII GATC 3 cut(s) 59, 82, 91
Eam1104I CTCTTC 1 cut(s) 177
EarI CTCTTC 1 cut(s) 177
EcoT22I ATGCAT 1 cut(s) 223
FaiI YATR 6 cut(s) 57, 123, 141, 234, 248, 265
FokI GGATG 3 cut(s) 102, 143, 208
HincII GTYRAC 1 cut(s) 201
HindII GTYRAC 1 cut(s) 201
HinfI GANTC 1 cut(s) 72
Hpy166II GTNNAC 1 cut(s) 201
Hpy188I TCNGA 1 cut(s) 181
Hpy8I GTNNAC 1 cut(s) 201
HpyCH4V TGCA 1 cut(s) 221
Kzo9I GATC 3 cut(s) 59, 82, 91
LpnPI CCDG 4 cut(s) 55, 90, 110, 169
LweI GCATC 3 cut(s) 149, 208, 230
MaeIII GTNAC 1 cut(s) 106
MalI GATC 3 cut(s) 61, 84, 93
MboI GATC 3 cut(s) 59, 82, 91
MboII GAAGA 1 cut(s) 194
MflI RGATCY 1 cut(s) 59
MluCI AATT 1 cut(s) 52
MmeI TCCRAC 1 cut(s) 159
MnlI CCTC 3 cut(s) 38, 121, 178
Mph1103I ATGCAT 1 cut(s) 223
MvnI CGCG 1 cut(s) 69
NdeII GATC 3 cut(s) 59, 82, 91
NsiI ATGCAT 1 cut(s) 223
PfeI GAWTC 1 cut(s) 72
PsiI TTATAA 1 cut(s) 265
PstNI CAGNNNCTG 1 cut(s) 257
PsuI RGATCY 1 cut(s) 59
Sau3AI GATC 3 cut(s) 59, 82, 91
SetI ASST 1 cut(s) 256
SfaNI GCATC 3 cut(s) 149, 208, 230
SmlI CTYRAG 1 cut(s) 226
SmoI CTYRAG 1 cut(s) 226
Sse9I AATT 1 cut(s) 52
SsiI CCGC 1 cut(s) 69
TaqI TCGA 1 cut(s) 8
TasI AATT 1 cut(s) 52
TfiI GAWTC 1 cut(s) 72
TspDTI ATGAA 1 cut(s) 147
Zsp2I ATGCAT 1 cut(s) 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.