RchiOBHm_Chr6g0265881

Belongs to the RuvB family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
21897654 .. 21900199
2546 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23843

Sequence Viewer

Length: 255 bp
ATGACACCATGGGACCCAGTGTTAAGTAAGTCCAGTGGTCCTGACAGGGAGTTGCAGGAGTGTAAGGAGGTTGTGCATTGCGTCACACTTCATGAGATTGATGTCATCAACAGCAAAACACAAGGATTTCTGGCTCTCTTTACAGGAGATACTGGTGAAATTCATTCAGAAGTGAGAGAACAGATTGACACACAGGTAGCAGAGTGTAGAGGAAGGGAAGGCAGAAATTGTGCCAGGTGTTCTCTTCATAGATGA

Protein Analysis

84

Amino Acids

9.45

Weight (kDa)

5.47

Isoelectric Point (pI)

28.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TIP49 PF06068 14 - 70 1.7e-16 TIP49 P-loop domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 159
AjnI CCWGG 1 cut(s) 233
ApoI RAATTY 1 cut(s) 159
AspS9I GGNCC 2 cut(s) 13, 38
AsuHPI GGTGA 1 cut(s) 167
AvaII GGWCC 2 cut(s) 13, 38
BciT130I CCWGG 1 cut(s) 235
Bme1390I CCNGG 1 cut(s) 235
Bme18I GGWCC 2 cut(s) 13, 38
BmgT120I GGNCC 2 cut(s) 13, 38
BmiI GGNNCC 2 cut(s) 14, 15
BmrFI CCNGG 1 cut(s) 235
BmrI ACTGGG 1 cut(s) 11
BmuI ACTGGG 1 cut(s) 11
BsaJI CCNNGG 1 cut(s) 8
Bse1I ACTGG 3 cut(s) 17, 33, 157
Bse3DI GCAATG 1 cut(s) 76
BseBI CCWGG 1 cut(s) 235
BseDI CCNNGG 1 cut(s) 8
BseMI GCAATG 1 cut(s) 76
BseNI ACTGG 3 cut(s) 17, 33, 157
BslFI GGGAC 1 cut(s) 26
BsmFI GGGAC 1 cut(s) 26
Bsp19I CCATGG 1 cut(s) 8
BspHI TCATGA 1 cut(s) 91
BspLI GGNNCC 2 cut(s) 14, 15
BsrDI GCAATG 1 cut(s) 76
BsrI ACTGG 3 cut(s) 17, 33, 157
BssECI CCNNGG 1 cut(s) 8
BssT1I CCWWGG 1 cut(s) 8
Bst2UI CCWGG 1 cut(s) 235
Bst6I CTCTTC 1 cut(s) 249
BstDSI CCRYGG 1 cut(s) 8
BstNI CCWGG 1 cut(s) 235
BstSCI CCNGG 1 cut(s) 233
BtgI CCRYGG 1 cut(s) 8
BtsIMutI CAGTG 2 cut(s) 24, 40
CciI TCATGA 1 cut(s) 91
Cfr13I GGNCC 2 cut(s) 13, 38
CseI GACGC 1 cut(s) 70
CviAII CATG 2 cut(s) 9, 92
CviJI RGCY 1 cut(s) 134
CviKI_1 RGCY 1 cut(s) 134
Eam1104I CTCTTC 1 cut(s) 249
EarI CTCTTC 1 cut(s) 249
Eco130I CCWWGG 1 cut(s) 8
Eco47I GGWCC 2 cut(s) 13, 38
EcoO109I RGGNCCY 1 cut(s) 13
EcoRII CCWGG 1 cut(s) 233
EcoT14I CCWWGG 1 cut(s) 8
ErhI CCWWGG 1 cut(s) 8
FaeI CATG 2 cut(s) 12, 95
FaiI YATR 3 cut(s) 10, 93, 249
FaqI GGGAC 1 cut(s) 26
FatI CATG 2 cut(s) 8, 91
HgaI GACGC 1 cut(s) 70
Hin1II CATG 2 cut(s) 12, 95
HphI GGTGA 1 cut(s) 167
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 2 cut(s) 41, 92
HpyAV CCTTC 2 cut(s) 207, 212
HpyCH4V TGCA 2 cut(s) 55, 76
Hsp92II CATG 2 cut(s) 12, 95
KflI GGGWCCC 1 cut(s) 13
MaeIII GTNAC 1 cut(s) 82
MboII GAAGA 1 cut(s) 236
MluCI AATT 2 cut(s) 159, 226
MnlI CCTC 2 cut(s) 61, 203
MseI TTAA 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 235
MvaI CCWGG 1 cut(s) 235
NcoI CCATGG 1 cut(s) 8
NlaIII CATG 2 cut(s) 12, 95
NlaIV GGNNCC 2 cut(s) 14, 15
NmuCI GTSAC 1 cut(s) 82
PagI TCATGA 1 cut(s) 91
PpuMI RGGWCCY 1 cut(s) 13
Psp5II RGGWCCY 1 cut(s) 13
Psp6I CCWGG 1 cut(s) 233
PspGI CCWGG 1 cut(s) 233
PspN4I GGNNCC 2 cut(s) 14, 15
PspPI GGNCC 2 cut(s) 13, 38
PspPPI RGGWCCY 1 cut(s) 13
SaqAI TTAA 1 cut(s) 23
Sau96I GGNCC 2 cut(s) 13, 38
ScrFI CCNGG 1 cut(s) 235
SetI ASST 3 cut(s) 72, 198, 239
SinI GGWCC 2 cut(s) 13, 38
Sse9I AATT 2 cut(s) 159, 226
StyD4I CCNGG 1 cut(s) 233
StyI CCWWGG 1 cut(s) 8
TasI AATT 2 cut(s) 159, 226
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TscAI CASTG 2 cut(s) 24, 40
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 3 cut(s) 80, 152, 236
TspRI CASTG 2 cut(s) 24, 40
VpaK11BI GGWCC 2 cut(s) 13, 38
XapI RAATTY 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.