RchiOBHm_Chr6g0265871

Belongs to the RuvB family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
21896912 .. 21897652
741 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23842

Sequence Viewer

Length: 162 bp
ATGCTTGCCATTGAGTGCTTTTCATTTTTCAATAGTGCTTTGGAGAATGAGATGGCTCCAATTTTAGTTATTGCTACGAAGAGAGGGATCACTACGATCAGAGGCACAAACTATAAATCCCCCCATGGGATTCCAATTGATCCCTTGATCGCCTGCATATAA

Protein Analysis

53

Amino Acids

5.79

Weight (kDa)

6.52

Isoelectric Point (pI)

45.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TIP49 PF06068 1 - 49 7.8e-20 TIP49 P-loop domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 95, 134
AfiI CCNNNNNNNGG 1 cut(s) 126
AgsI TTSAA 1 cut(s) 31
AlwI GGATC 2 cut(s) 95, 134
BccI CCATC 1 cut(s) 46
BmiI GGNNCC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 124
Bsc4I CCNNNNNNNGG 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 126
BslI CCNNNNNNNGG 1 cut(s) 126
Bsp143I GATC 4 cut(s) 87, 96, 139, 147
Bsp19I CCATGG 1 cut(s) 124
BspLI GGNNCC 1 cut(s) 57
BspPI GGATC 2 cut(s) 95, 134
BssECI CCNNGG 1 cut(s) 124
BssMI GATC 4 cut(s) 87, 96, 139, 147
BssT1I CCWWGG 1 cut(s) 124
Bst6I CTCTTC 1 cut(s) 74
BstC8I GCNNGC 2 cut(s) 6, 154
BstDSI CCRYGG 1 cut(s) 124
BstKTI GATC 4 cut(s) 90, 99, 142, 150
BstMBI GATC 4 cut(s) 87, 96, 139, 147
BtgI CCRYGG 1 cut(s) 124
Cac8I GCNNGC 2 cut(s) 6, 154
CviAII CATG 1 cut(s) 125
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
DpnI GATC 4 cut(s) 89, 98, 141, 149
DpnII GATC 4 cut(s) 87, 96, 139, 147
Eam1104I CTCTTC 1 cut(s) 74
EarI CTCTTC 1 cut(s) 74
Eco130I CCWWGG 1 cut(s) 124
EcoT14I CCWWGG 1 cut(s) 124
ErhI CCWWGG 1 cut(s) 124
FaeI CATG 1 cut(s) 128
FaiI YATR 4 cut(s) 114, 126, 158, 160
FatI CATG 1 cut(s) 124
Hin1II CATG 1 cut(s) 128
HinfI GANTC 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 101
HpyCH4V TGCA 1 cut(s) 156
Hsp92II CATG 1 cut(s) 128
Kzo9I GATC 4 cut(s) 87, 96, 139, 147
LmnI GCTCC 1 cut(s) 61
MalI GATC 4 cut(s) 89, 98, 141, 149
MboI GATC 4 cut(s) 87, 96, 139, 147
MboII GAAGA 1 cut(s) 91
MfeI CAATTG 1 cut(s) 135
MluCI AATT 2 cut(s) 60, 135
MnlI CCTC 2 cut(s) 77, 95
MunI CAATTG 1 cut(s) 135
NcoI CCATGG 1 cut(s) 124
NdeII GATC 4 cut(s) 87, 96, 139, 147
NlaIII CATG 1 cut(s) 128
NlaIV GGNNCC 1 cut(s) 57
PfeI GAWTC 1 cut(s) 130
PspN4I GGNNCC 1 cut(s) 57
Sau3AI GATC 4 cut(s) 87, 96, 139, 147
SgeI CNNG 3 cut(s) 17, 137, 157
Sse9I AATT 2 cut(s) 60, 135
StyI CCWWGG 1 cut(s) 124
TasI AATT 2 cut(s) 60, 135
TfiI GAWTC 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.