MD09G1230400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0001322
Physical Location & Seq
Reverse (-)
28539444 .. 28542672
3229 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1230400.v1.1.491

Sequence Viewer

Length: 297 bp
ATGGAGTTTTGGGACAAGATGATCTTCCCTGTCCGCCGTCTCTGGCTTGCCGTCTCTACCCGCGTCAAGGATCGCAAAAATGGTGGTGGGCTTCTGAAGCTTCACGATGATGTGCAATCGTGTGGGTATCAAGATGTGCAAGTGATGTGGCAGATGTTGAGTAGAGAAACAACAGACAACCATCCGCCCTCGGCCAAACGCAAACACCAAAGACTCTTCTGGAGAGTTTTCGAGTGGTCTTCTAGCAACACTCGTAGTAAAAACTCAGCTTTGCGATCCGAACACGAAGAATTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.77

Weight (kDa)

9.8

Isoelectric Point (pI)

58.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 63
AciI CCGC 3 cut(s) 34, 61, 185
AclWI GGATC 2 cut(s) 78, 270
AcoI YGGCCR 1 cut(s) 192
AcsI RAATTY 1 cut(s) 290
AcuI CTGAAG 1 cut(s) 116
AfiI CCNNNNNNNGG 1 cut(s) 67
AluBI AGCT 2 cut(s) 100, 269
AluI AGCT 2 cut(s) 100, 269
Alw26I GTCTC 2 cut(s) 44, 58
AlwI GGATC 2 cut(s) 78, 270
AoxI GGCC 1 cut(s) 192
ApoI RAATTY 1 cut(s) 290
BbsI GAAGAC 1 cut(s) 231
BccI CCATC 1 cut(s) 189
BceAI ACGGC 2 cut(s) 21, 35
BcoDI GTCTC 2 cut(s) 44, 58
BfaI CTAG 1 cut(s) 243
BpiI GAAGAC 1 cut(s) 231
BpmI CTGGAG 1 cut(s) 241
BsaJI CCNNGG 1 cut(s) 189
Bsc4I CCNNNNNNNGG 1 cut(s) 67
BseDI CCNNGG 1 cut(s) 189
BseGI GGATG 1 cut(s) 181
BseLI CCNNNNNNNGG 1 cut(s) 67
BseMII CTCAG 1 cut(s) 279
Bsh1236I CGCG 1 cut(s) 63
BshFI GGCC 1 cut(s) 194
BslFI GGGAC 1 cut(s) 26
BslI CCNNNNNNNGG 1 cut(s) 67
BsmAI GTCTC 2 cut(s) 44, 58
BsmBI CGTCTC 2 cut(s) 44, 58
BsmFI GGGAC 1 cut(s) 26
BsnI GGCC 1 cut(s) 194
Bsp143I GATC 3 cut(s) 21, 70, 275
BspACI CCGC 3 cut(s) 34, 61, 185
BspANI GGCC 1 cut(s) 194
BspCNI CTCAG 1 cut(s) 278
BspFNI CGCG 1 cut(s) 63
BspPI GGATC 2 cut(s) 78, 270
BssECI CCNNGG 1 cut(s) 189
BssMI GATC 3 cut(s) 21, 70, 275
Bst6I CTCTTC 1 cut(s) 221
BstC8I GCNNGC 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 265
BstF5I GGATG 1 cut(s) 181
BstFNI CGCG 1 cut(s) 63
BstKTI GATC 3 cut(s) 24, 73, 278
BstMAI GTCTC 2 cut(s) 44, 58
BstMBI GATC 3 cut(s) 21, 70, 275
BstMWI GCNNNNNNNGC 1 cut(s) 97
BstUI CGCG 1 cut(s) 63
BstV2I GAAGAC 1 cut(s) 231
BsuRI GGCC 1 cut(s) 194
BtsCI GGATG 1 cut(s) 181
Cac8I GCNNGC 1 cut(s) 48
CseI GACGC 1 cut(s) 52
CspCI CAANNNNNGTGG 4 cut(s) 64, 99, 128, 163
CviJI RGCY 5 cut(s) 46, 91, 100, 194, 269
CviKI_1 RGCY 5 cut(s) 46, 91, 100, 194, 269
DdeI CTNAG 1 cut(s) 265
DpnI GATC 3 cut(s) 23, 72, 277
DpnII GATC 3 cut(s) 21, 70, 275
EaeI YGGCCR 1 cut(s) 192
Eam1104I CTCTTC 1 cut(s) 221
EarI CTCTTC 1 cut(s) 221
EciI GGCGGA 2 cut(s) 23, 174
Eco57I CTGAAG 1 cut(s) 116
EcoRI GAATTC 1 cut(s) 290
Esp3I CGTCTC 2 cut(s) 44, 58
FalI AAGNNNNNCTT 2 cut(s) 8, 40
FaqI GGGAC 1 cut(s) 26
FauI CCCGC 1 cut(s) 68
FokI GGATG 1 cut(s) 168
FspBI CTAG 1 cut(s) 243
GsuI CTGGAG 1 cut(s) 241
HaeIII GGCC 1 cut(s) 194
HgaI GACGC 1 cut(s) 52
HindIII AAGCTT 1 cut(s) 98
HinfI GANTC 1 cut(s) 213
Hpy188I TCNGA 2 cut(s) 96, 280
Hpy188III TCNNGA 3 cut(s) 104, 131, 220
HpyCH4V TGCA 2 cut(s) 115, 139
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
HpyF3I CTNAG 1 cut(s) 265
Kzo9I GATC 3 cut(s) 21, 70, 275
LpnPI CCDG 3 cut(s) 28, 42, 205
MaeI CTAG 1 cut(s) 243
MalI GATC 3 cut(s) 23, 72, 277
MboI GATC 3 cut(s) 21, 70, 275
MboII GAAGA 3 cut(s) 16, 208, 231
MluCI AATT 1 cut(s) 290
MlyI GAGTC 1 cut(s) 207
MnlI CCTC 1 cut(s) 199
MslI CAYNNNNRTG 1 cut(s) 108
MvnI CGCG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 97
NdeII GATC 3 cut(s) 21, 70, 275
NmeAIII GCCGAG 1 cut(s) 170
PleI GAGTC 1 cut(s) 207
PpsI GAGTC 1 cut(s) 207
RseI CAYNNNNRTG 1 cut(s) 108
Sau3AI GATC 3 cut(s) 21, 70, 275
SchI GAGTC 1 cut(s) 207
SetI ASST 2 cut(s) 102, 271
SmiMI CAYNNNNRTG 1 cut(s) 108
Sse9I AATT 1 cut(s) 290
SsiI CCGC 3 cut(s) 34, 61, 185
SspMI CTAG 1 cut(s) 243
TaqI TCGA 1 cut(s) 231
TasI AATT 1 cut(s) 290
XapI RAATTY 1 cut(s) 290
XspI CTAG 1 cut(s) 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.