RchiOBHm_Chr6g0284921

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0001322
Physical Location & Seq
Reverse (-)
48243722 .. 48244273
552 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25554

Sequence Viewer

Length: 150 bp
ATGGTGAGCAAAACGGCGCCGTGTAAGGAGAGGGCGAGTTGGGAGATTAGGGAGGCTAGGGTATTCTCGTTCGACGATATTGCGGTGGTGGTTTCTACATGTGGCGATGAGAGTGCCGATGGTTTAGAGGTTACTATAGGTGGAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.25

Weight (kDa)

4.36

Isoelectric Point (pI)

21.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 16
AciI CCGC 1 cut(s) 83
AcyI GRCGYC 1 cut(s) 17
AflIII ACRYGT 1 cut(s) 98
AspLEI GCGC 1 cut(s) 19
AsuHPI GGTGA 1 cut(s) 16
BanI GGYRCC 1 cut(s) 16
BccI CCATC 1 cut(s) 113
BceAI ACGGC 2 cut(s) 4, 30
BcgI CGANNNNNNTGC 4 cut(s) 62, 95, 96, 129
BfaI CTAG 1 cut(s) 57
BfmI CTRYAG 1 cut(s) 135
BfoI RGCGCY 1 cut(s) 20
BmiI GGNNCC 1 cut(s) 18
BsaHI GRCGYC 1 cut(s) 17
BshNI GGYRCC 1 cut(s) 16
BspACI CCGC 1 cut(s) 83
BspLI GGNNCC 1 cut(s) 18
BspT107I GGYRCC 1 cut(s) 16
BssNI GRCGYC 1 cut(s) 17
BstACI GRCGYC 1 cut(s) 17
BstH2I RGCGCY 1 cut(s) 20
BstHHI GCGC 1 cut(s) 19
BstNSI RCATGY 1 cut(s) 102
BstSFI CTRYAG 1 cut(s) 135
BtgZI GCGATG 1 cut(s) 120
CfoI GCGC 1 cut(s) 19
CviAII CATG 1 cut(s) 99
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
DinI GGCGCC 1 cut(s) 18
EgeI GGCGCC 1 cut(s) 18
EheI GGCGCC 1 cut(s) 18
FaeI CATG 1 cut(s) 102
FaiI YATR 2 cut(s) 100, 137
FatI CATG 1 cut(s) 98
FspBI CTAG 1 cut(s) 57
GlaI GCGC 1 cut(s) 18
HaeII RGCGCY 1 cut(s) 20
HhaI GCGC 1 cut(s) 19
Hin1I GRCGYC 1 cut(s) 17
Hin1II CATG 1 cut(s) 102
Hin6I GCGC 1 cut(s) 17
HinP1I GCGC 1 cut(s) 17
HphI GGTGA 1 cut(s) 16
Hpy99I CGWCG 1 cut(s) 77
Hsp92I GRCGYC 1 cut(s) 17
Hsp92II CATG 1 cut(s) 102
HspAI GCGC 1 cut(s) 17
KasI GGCGCC 1 cut(s) 16
MaeI CTAG 1 cut(s) 57
MaeIII GTNAC 1 cut(s) 130
Mly113I GGCGCC 1 cut(s) 17
MnlI CCTC 3 cut(s) 24, 46, 121
MseI TTAA 1 cut(s) 148
NarI GGCGCC 1 cut(s) 17
NlaIII CATG 1 cut(s) 102
NlaIV GGNNCC 1 cut(s) 18
NspI RCATGY 1 cut(s) 102
PciI ACATGT 1 cut(s) 98
PluTI GGCGCC 1 cut(s) 20
PscI ACATGT 1 cut(s) 98
PspN4I GGNNCC 1 cut(s) 18
SaqAI TTAA 1 cut(s) 148
SetI ASST 2 cut(s) 132, 142
SfcI CTRYAG 1 cut(s) 135
SfoI GGCGCC 1 cut(s) 18
SgeI CNNG 5 cut(s) 33, 48, 69, 79, 111
SsiI CCGC 1 cut(s) 83
SspDI GGCGCC 1 cut(s) 16
SspMI CTAG 1 cut(s) 57
TaqI TCGA 1 cut(s) 72
Tru1I TTAA 1 cut(s) 148
Tru9I TTAA 1 cut(s) 148
XceI RCATGY 1 cut(s) 102
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.