pycom15g06760

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0001322
Physical Location & Seq
Reverse (-)
4166075 .. 4166546
472 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g06760.2

Sequence Viewer

Length: 282 bp
ATGGCGTGGTGGCGGGAGATGAAGTTCCCGATGCGGAAAATCTGGAGCCGGGTCGCAACCCACCCCGGCATCCACAAATCGGGGCTACCGAAGCTAAGACACGATATAAGAACATGCGAGTACGAGGACGTGCATGTGATGTGGAGGATGCTCAACCCTAACGACAGATCAGAGACCATTCAATTGGGAGGAGGAGGAGGAGGAGAGACACCCAAGAAGAAACGTTTTTCCAATTTGCTCGATTGGATTAAACGAGCTCCATCCGTTTGCCGTGCCTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.93

Weight (kDa)

10.28

Isoelectric Point (pI)

43.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 13, 34
AclI AACGTT 1 cut(s) 223
AfaI GTAC 1 cut(s) 122
AfiI CCNNNNNNNGG 1 cut(s) 79
AgsI TTSAA 1 cut(s) 182
AjiI CACGTC 1 cut(s) 130
AloI GAACNNNNNNTCC 2 cut(s) 8, 40
AluBI AGCT 2 cut(s) 94, 257
AluI AGCT 2 cut(s) 94, 257
Alw21I GWGCWC 1 cut(s) 259
Alw26I GTCTC 2 cut(s) 167, 200
AsuC2I CCSGG 2 cut(s) 50, 66
BanII GRGCYC 1 cut(s) 259
Bbv12I GWGCWC 1 cut(s) 259
BccI CCATC 1 cut(s) 268
BceAI ACGGC 1 cut(s) 255
BcnI CCSGG 2 cut(s) 50, 66
BcoDI GTCTC 2 cut(s) 167, 200
Bme1390I CCNGG 2 cut(s) 50, 66
BmgBI CACGTC 1 cut(s) 130
BmiI GGNNCC 1 cut(s) 47
BmrFI CCNGG 2 cut(s) 50, 66
BmsI GCATC 3 cut(s) 21, 78, 138
BpmI CTGGAG 1 cut(s) 64
BpuMI CCSGG 2 cut(s) 50, 66
BsaI GGTCTC 1 cut(s) 167
BsaJI CCNNGG 1 cut(s) 64
BsaXI ACNNNNNCTCC 2 cut(s) 8, 38
Bsc4I CCNNNNNNNGG 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 64
BseGI GGATG 3 cut(s) 69, 153, 260
BseLI CCNNNNNNNGG 1 cut(s) 79
BseRI GAGGAG 5 cut(s) 204, 207, 210, 213, 216
BsiHKAI GWGCWC 1 cut(s) 259
BsiSI CCGG 2 cut(s) 49, 66
BslI CCNNNNNNNGG 1 cut(s) 79
BsmAI GTCTC 2 cut(s) 167, 200
Bso31I GGTCTC 1 cut(s) 167
Bsp1286I GDGCHC 1 cut(s) 259
Bsp143I GATC 1 cut(s) 167
BspACI CCGC 2 cut(s) 13, 34
BspLI GGNNCC 1 cut(s) 47
BspTNI GGTCTC 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 64
BssMI GATC 1 cut(s) 167
BstDEI CTNAG 1 cut(s) 95
BstF5I GGATG 3 cut(s) 69, 153, 260
BstKTI GATC 1 cut(s) 170
BstMAI GTCTC 2 cut(s) 167, 200
BstMBI GATC 1 cut(s) 167
BstMWI GCNNNNNNNGC 1 cut(s) 91
BstNSI RCATGY 2 cut(s) 117, 137
BstSCI CCNGG 2 cut(s) 48, 64
BstXI CCANNNNNNTGG 1 cut(s) 184
BtrI CACGTC 1 cut(s) 130
BtsCI GGATG 3 cut(s) 69, 153, 260
Csp6I GTAC 1 cut(s) 121
CviAII CATG 2 cut(s) 114, 134
CviJI RGCY 4 cut(s) 48, 85, 94, 257
CviKI_1 RGCY 4 cut(s) 48, 85, 94, 257
CviQI GTAC 1 cut(s) 121
DdeI CTNAG 1 cut(s) 95
DpnI GATC 1 cut(s) 169
DpnII GATC 1 cut(s) 167
Ecl136II GAGCTC 1 cut(s) 257
Eco24I GRGCYC 1 cut(s) 259
Eco31I GGTCTC 1 cut(s) 167
Eco53kI GAGCTC 1 cut(s) 257
EcoICRI GAGCTC 1 cut(s) 257
EcoT38I GRGCYC 1 cut(s) 259
FaeI CATG 2 cut(s) 117, 137
FaiI YATR 3 cut(s) 107, 115, 135
FatI CATG 2 cut(s) 113, 133
FauI CCCGC 1 cut(s) 6
FokI GGATG 3 cut(s) 56, 160, 247
FriOI GRGCYC 1 cut(s) 259
GsuI CTGGAG 1 cut(s) 64
HapII CCGG 2 cut(s) 49, 66
Hin1II CATG 2 cut(s) 117, 137
HpaII CCGG 2 cut(s) 49, 66
Hpy188I TCNGA 2 cut(s) 172, 281
Hpy188III TCNNGA 2 cut(s) 28, 43
HpyCH4IV ACGT 2 cut(s) 129, 223
HpyCH4V TGCA 1 cut(s) 133
HpyF10VI GCNNNNNNNGC 1 cut(s) 91
HpyF3I CTNAG 1 cut(s) 95
HpySE526I ACGT 2 cut(s) 129, 223
Hsp92II CATG 2 cut(s) 117, 137
Kzo9I GATC 1 cut(s) 167
LmnI GCTCC 2 cut(s) 45, 262
LpnPI CCDG 3 cut(s) 28, 62, 79
LweI GCATC 3 cut(s) 21, 78, 138
MaeII ACGT 2 cut(s) 129, 223
MalI GATC 1 cut(s) 169
MboI GATC 1 cut(s) 167
MboII GAAGA 1 cut(s) 229
MfeI CAATTG 1 cut(s) 182
MhlI GDGCHC 1 cut(s) 259
MluCI AATT 2 cut(s) 182, 232
MnlI CCTC 7 cut(s) 118, 138, 182, 185, 188, 191, 194
MseI TTAA 1 cut(s) 249
MspI CCGG 2 cut(s) 49, 66
MspR9I CCNGG 2 cut(s) 50, 66
MunI CAATTG 1 cut(s) 182
MwoI GCNNNNNNNGC 1 cut(s) 91
NciI CCSGG 2 cut(s) 50, 66
NdeII GATC 1 cut(s) 167
NlaIII CATG 2 cut(s) 117, 137
NlaIV GGNNCC 1 cut(s) 47
NspI RCATGY 2 cut(s) 117, 137
PcsI WCGNNNNNNNCGW 1 cut(s) 86
Psp124BI GAGCTC 1 cut(s) 259
Psp1406I AACGTT 1 cut(s) 223
PspN4I GGNNCC 1 cut(s) 47
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
SacI GAGCTC 1 cut(s) 259
SaqAI TTAA 1 cut(s) 249
Sau3AI GATC 1 cut(s) 167
ScrFI CCNGG 2 cut(s) 50, 66
SduI GDGCHC 1 cut(s) 259
SetI ASST 4 cut(s) 96, 132, 226, 259
SfaNI GCATC 3 cut(s) 21, 78, 138
Sse9I AATT 2 cut(s) 182, 232
SsiI CCGC 2 cut(s) 13, 34
SstI GAGCTC 1 cut(s) 259
StyD4I CCNGG 2 cut(s) 48, 64
TaiI ACGT 2 cut(s) 132, 226
TaqI TCGA 1 cut(s) 240
TasI AATT 2 cut(s) 182, 232
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TspDTI ATGAA 1 cut(s) 35
TspGWI ACGGA 1 cut(s) 253
XceI RCATGY 2 cut(s) 117, 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.