Rmu_co8501331.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8501331.1
OG0001322
Physical Location & Seq
Forward (+)
1 .. 1038
1038 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8501331.1_g000001.1.cds

Sequence Viewer

Length: 200 bp
gtgctggtctgttgaagcttcacgacgatgtacaaacttgtggctatcaagatgtgcaagtgatgtggcagatgctgagcagagaagctgagctgataaatcaccaccatgccaaacgtaaacagcgacccttctggagagtttttgaatggtctaacaaccatagtaaagcctcgtccctctctgcaaatcatgcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.64

Weight (kDa)

9.05

Isoelectric Point (pI)

25.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 32
AgsI TTSAA 2 cut(s) 15, 148
AluBI AGCT 3 cut(s) 18, 88, 93
AluI AGCT 3 cut(s) 18, 88, 93
AlwNI CAGNNNCTG 1 cut(s) 75
AsuHPI GGTGA 1 cut(s) 94
BlpI GCTNAGC 2 cut(s) 76, 89
BmsI GCATC 1 cut(s) 62
BpmI CTGGAG 1 cut(s) 156
Bpu1102I GCTNAGC 2 cut(s) 76, 89
BseMII CTCAG 2 cut(s) 67, 80
BslFI GGGAC 1 cut(s) 162
BsmFI GGGAC 1 cut(s) 162
Bsp1407I TGTACA 1 cut(s) 30
Bsp1720I GCTNAGC 2 cut(s) 76, 89
BspCNI CTCAG 2 cut(s) 68, 81
BsrGI TGTACA 1 cut(s) 30
BstAPI GCANNNNNTGC 1 cut(s) 193
BstAUI TGTACA 1 cut(s) 30
BstDEI CTNAG 2 cut(s) 76, 89
BstMWI GCNNNNNNNGC 1 cut(s) 193
CaiI CAGNNNCTG 1 cut(s) 75
Csp6I GTAC 1 cut(s) 31
CspCI CAANNNNNGTGG 2 cut(s) 46, 81
CviAII CATG 2 cut(s) 109, 193
CviJI RGCY 5 cut(s) 18, 44, 88, 93, 172
CviKI_1 RGCY 5 cut(s) 18, 44, 88, 93, 172
CviQI GTAC 1 cut(s) 31
DdeI CTNAG 2 cut(s) 76, 89
FaeI CATG 2 cut(s) 112, 196
FaiI YATR 3 cut(s) 110, 164, 194
FaqI GGGAC 1 cut(s) 162
FatI CATG 2 cut(s) 108, 192
GsuI CTGGAG 1 cut(s) 156
Hin1II CATG 2 cut(s) 112, 196
HindIII AAGCTT 1 cut(s) 16
HphI GGTGA 1 cut(s) 94
Hpy166II GTNNAC 1 cut(s) 121
Hpy188III TCNNGA 3 cut(s) 22, 49, 135
Hpy8I GTNNAC 1 cut(s) 121
Hpy99I CGWCG 1 cut(s) 28
HpyAV CCTTC 1 cut(s) 141
HpyCH4IV ACGT 1 cut(s) 117
HpyCH4V TGCA 2 cut(s) 57, 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 193
HpyF3I CTNAG 2 cut(s) 76, 89
HpySE526I ACGT 1 cut(s) 117
Hsp92II CATG 2 cut(s) 112, 196
LpnPI CCDG 1 cut(s) 120
LweI GCATC 1 cut(s) 62
MaeII ACGT 1 cut(s) 117
MnlI CCTC 2 cut(s) 183, 190
MslI CAYNNNNRTG 2 cut(s) 26, 107
MwoI GCNNNNNNNGC 1 cut(s) 193
NlaIII CATG 2 cut(s) 112, 196
PcsI WCGNNNNNNNCGW 1 cut(s) 123
PstNI CAGNNNCTG 1 cut(s) 75
RsaI GTAC 1 cut(s) 32
RsaNI GTAC 1 cut(s) 31
RseI CAYNNNNRTG 2 cut(s) 26, 107
SetI ASST 4 cut(s) 20, 90, 95, 120
SfaNI GCATC 1 cut(s) 62
SgeI CNNG 8 cut(s) 17, 34, 50, 61, 70, 121, 147, 186
SmiMI CAYNNNNRTG 2 cut(s) 26, 107
TaiI ACGT 1 cut(s) 120
TatI WGTACW 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.