MD16G1192800.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Forward (+)
17096086 .. 17096713
628 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1192800.v1.1.491

Sequence Viewer

Length: 210 bp
ATGGGGTGGCTGCACTCCATCCTCTCTCCTCTTAAGAAGATGTGGTTTCGCTTCCATTCCGCTCCGAAGAACAGAAGAGGGATTTACATTCTGTATGAGGATGTAAAATCCTGCCCCGACGAGGATGTGCATGTCTTGTGGTCAATACTAGTGGAGGCCCATACACATACACGTACTACACCTTTGCCTTTGCCACCATCAAAACCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.08

Weight (kDa)

9.36

Isoelectric Point (pI)

60.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 62
AciI CCGC 1 cut(s) 60
AfaI GTAC 1 cut(s) 175
AfiI CCNNNNNNNGG 1 cut(s) 121
AflII CTTAAG 1 cut(s) 32
AflIII ACRYGT 1 cut(s) 170
AhlI ACTAGT 1 cut(s) 148
AoxI GGCC 1 cut(s) 156
ApeKI GCWGC 1 cut(s) 10
AspS9I GGNCC 1 cut(s) 157
BccI CCATC 2 cut(s) 26, 205
BcuI ACTAGT 1 cut(s) 148
BfaI CTAG 1 cut(s) 149
BfrI CTTAAG 1 cut(s) 32
BisI GCNGC 1 cut(s) 11
BlsI GCNGC 1 cut(s) 12
BmgT120I GGNCC 1 cut(s) 157
BsaAI YACGTR 1 cut(s) 173
Bsc4I CCNNNNNNNGG 1 cut(s) 121
BseGI GGATG 3 cut(s) 18, 106, 130
BseLI CCNNNNNNNGG 1 cut(s) 121
BseRI GAGGAG 1 cut(s) 18
BshFI GGCC 1 cut(s) 158
BslI CCNNNNNNNGG 1 cut(s) 121
BsnI GGCC 1 cut(s) 158
BspACI CCGC 1 cut(s) 60
BspANI GGCC 1 cut(s) 158
BspTI CTTAAG 1 cut(s) 32
BsrBI CCGCTC 1 cut(s) 62
Bst6I CTCTTC 1 cut(s) 70
BstAFI CTTAAG 1 cut(s) 32
BstBAI YACGTR 1 cut(s) 173
BstF5I GGATG 3 cut(s) 18, 106, 130
BstNSI RCATGY 1 cut(s) 134
BsuRI GGCC 1 cut(s) 158
BtsCI GGATG 3 cut(s) 18, 106, 130
Cfr13I GGNCC 1 cut(s) 157
Csp6I GTAC 1 cut(s) 174
CspCI CAANNNNNGTGG 2 cut(s) 132, 167
CviAII CATG 2 cut(s) 131, 207
CviJI RGCY 2 cut(s) 10, 158
CviKI_1 RGCY 2 cut(s) 10, 158
CviQI GTAC 1 cut(s) 174
Eam1104I CTCTTC 1 cut(s) 70
EarI CTCTTC 1 cut(s) 70
FaeI CATG 2 cut(s) 134, 210
FaiI YATR 5 cut(s) 96, 132, 162, 168, 208
FatI CATG 2 cut(s) 130, 206
Fnu4HI GCNGC 1 cut(s) 11
FokI GGATG 3 cut(s) 5, 113, 137
Fsp4HI GCNGC 1 cut(s) 11
FspBI CTAG 1 cut(s) 149
GluI GCNGC 1 cut(s) 11
HaeIII GGCC 1 cut(s) 158
Hin1II CATG 2 cut(s) 134, 210
Hpy188I TCNGA 1 cut(s) 66
Hpy99I CGWCG 1 cut(s) 122
HpyCH4IV ACGT 1 cut(s) 172
HpyCH4V TGCA 2 cut(s) 13, 130
HpySE526I ACGT 1 cut(s) 172
Hsp92II CATG 2 cut(s) 134, 210
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 1 cut(s) 124
MaeI CTAG 1 cut(s) 149
MaeII ACGT 1 cut(s) 172
MbiI CCGCTC 1 cut(s) 62
MboII GAAGA 3 cut(s) 49, 79, 87
MnlI CCTC 6 cut(s) 32, 39, 71, 91, 115, 148
MseI TTAA 1 cut(s) 33
MspCI CTTAAG 1 cut(s) 32
NlaIII CATG 2 cut(s) 134, 210
NspI RCATGY 1 cut(s) 134
PkrI GCNGC 1 cut(s) 12
Ppu21I YACGTR 1 cut(s) 173
PspPI GGNCC 1 cut(s) 157
RsaI GTAC 1 cut(s) 175
RsaNI GTAC 1 cut(s) 174
SaqAI TTAA 1 cut(s) 33
SatI GCNGC 1 cut(s) 11
Sau96I GGNCC 1 cut(s) 157
SetI ASST 2 cut(s) 175, 184
SgeI CNNG 7 cut(s) 123, 128, 133, 143, 148, 161, 183
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
SpeI ACTAGT 1 cut(s) 148
SsiI CCGC 1 cut(s) 60
SspMI CTAG 1 cut(s) 149
TaiI ACGT 1 cut(s) 175
Tru1I TTAA 1 cut(s) 33
Tru9I TTAA 1 cut(s) 33
TseI GCWGC 1 cut(s) 10
Vha464I CTTAAG 1 cut(s) 32
XceI RCATGY 1 cut(s) 134
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.