Rmu_co8318957.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8318957.1
OG0001322
Physical Location & Seq
Forward (+)
1 .. 396
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8318957.1_g000001.1.cds

Sequence Viewer

Length: 287 bp
gtggtgctggtggtgatcagtgtggtggagtaggtggtctgctaaagcttaaagatgatgtgcaaatgtgtgggtaccaagatgtacacattatgtggaacatgttgagcaaagctcaacaggaggagattcagatcatggcaaaaactcggtcacctaccaagccgaatcagaagcaacgaagacgacaacgatcatcatgttctttcaggactttctttggaccagccacacagagctgcgtcttggttagactagaatccaatgcttcttcaatcttgagttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.39

Weight (kDa)

9.56

Isoelectric Point (pI)

77.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 74
AccB1I GGYRCC 1 cut(s) 74
AfaI GTAC 2 cut(s) 76, 86
AflIII ACRYGT 1 cut(s) 101
AgsI TTSAA 1 cut(s) 275
AluBI AGCT 3 cut(s) 48, 115, 239
AluI AGCT 3 cut(s) 48, 115, 239
ApeKI GCWGC 1 cut(s) 239
ArsI GACNNNNNNTTYG 2 cut(s) 136, 168
Asp718I GGTACC 1 cut(s) 74
AspS9I GGNCC 1 cut(s) 223
AsuHPI GGTGA 2 cut(s) 25, 146
AvaII GGWCC 1 cut(s) 223
BanI GGYRCC 1 cut(s) 74
BbsI GAAGAC 1 cut(s) 189
BbvI GCAGC 1 cut(s) 226
BclI TGATCA 1 cut(s) 15
BfaI CTAG 1 cut(s) 256
BisI GCNGC 1 cut(s) 240
BlsI GCNGC 1 cut(s) 241
Bme18I GGWCC 1 cut(s) 223
BmgT120I GGNCC 1 cut(s) 223
BmiI GGNNCC 1 cut(s) 76
BpiI GAAGAC 1 cut(s) 189
BplI GAGNNNNNCTC 2 cut(s) 99, 131
BsaBI GATNNNNATC 1 cut(s) 133
Bse8I GATNNNNATC 1 cut(s) 133
BseJI GATNNNNATC 1 cut(s) 133
BseRI GAGGAG 1 cut(s) 139
BseXI GCAGC 1 cut(s) 226
BshNI GGYRCC 1 cut(s) 74
Bsp1407I TGTACA 1 cut(s) 84
Bsp143I GATC 3 cut(s) 15, 134, 193
BspLI GGNNCC 1 cut(s) 76
BspT107I GGYRCC 1 cut(s) 74
BsrGI TGTACA 1 cut(s) 84
BssMI GATC 3 cut(s) 15, 134, 193
BstAUI TGTACA 1 cut(s) 84
BstEII GGTNACC 1 cut(s) 152
BstKTI GATC 3 cut(s) 18, 137, 196
BstMBI GATC 3 cut(s) 15, 134, 193
BstNSI RCATGY 1 cut(s) 105
BstPI GGTNACC 1 cut(s) 152
BstV1I GCAGC 1 cut(s) 226
BstV2I GAAGAC 1 cut(s) 189
BtsIMutI CAGTG 1 cut(s) 25
Cfr13I GGNCC 1 cut(s) 223
CseI GACGC 1 cut(s) 231
Csp6I GTAC 2 cut(s) 75, 85
CviAII CATG 3 cut(s) 102, 138, 200
CviJI RGCY 5 cut(s) 48, 115, 165, 229, 239
CviKI_1 RGCY 5 cut(s) 48, 115, 165, 229, 239
CviQI GTAC 2 cut(s) 75, 85
DpnI GATC 3 cut(s) 17, 136, 195
DpnII GATC 3 cut(s) 15, 134, 193
Eco47I GGWCC 1 cut(s) 223
Eco91I GGTNACC 1 cut(s) 152
EcoO65I GGTNACC 1 cut(s) 152
FaeI CATG 3 cut(s) 105, 141, 203
FaiI YATR 4 cut(s) 94, 103, 139, 201
FatI CATG 3 cut(s) 101, 137, 199
FbaI TGATCA 1 cut(s) 15
Fnu4HI GCNGC 1 cut(s) 240
Fsp4HI GCNGC 1 cut(s) 240
FspBI CTAG 1 cut(s) 256
GluI GCNGC 1 cut(s) 240
HgaI GACGC 1 cut(s) 231
Hin1II CATG 3 cut(s) 105, 141, 203
HindIII AAGCTT 1 cut(s) 46
HinfI GANTC 3 cut(s) 129, 168, 259
HphI GGTGA 2 cut(s) 25, 146
Hpy166II GTNNAC 1 cut(s) 87
Hpy188I TCNGA 2 cut(s) 134, 173
Hpy188III TCNNGA 2 cut(s) 210, 279
Hpy8I GTNNAC 1 cut(s) 87
HpyCH4V TGCA 1 cut(s) 63
Hsp92II CATG 3 cut(s) 105, 141, 203
KpnI GGTACC 1 cut(s) 78
Ksp22I TGATCA 1 cut(s) 15
Kzo9I GATC 3 cut(s) 15, 134, 193
LpnPI CCDG 3 cut(s) 106, 195, 239
Lsp1109I GCAGC 1 cut(s) 226
MaeI CTAG 1 cut(s) 256
MaeIII GTNAC 1 cut(s) 152
MalI GATC 3 cut(s) 17, 136, 195
MboI GATC 3 cut(s) 15, 134, 193
MboII GAAGA 2 cut(s) 194, 263
MnlI CCTC 1 cut(s) 117
MseI TTAA 1 cut(s) 50
NdeII GATC 3 cut(s) 15, 134, 193
NlaIII CATG 3 cut(s) 105, 141, 203
NlaIV GGNNCC 1 cut(s) 76
NmuCI GTSAC 1 cut(s) 152
NspI RCATGY 1 cut(s) 105
PciI ACATGT 1 cut(s) 101
PfeI GAWTC 3 cut(s) 129, 168, 259
PkrI GCNGC 1 cut(s) 241
PscI ACATGT 1 cut(s) 101
PspEI GGTNACC 1 cut(s) 152
PspN4I GGNNCC 1 cut(s) 76
PspPI GGNCC 1 cut(s) 223
RsaI GTAC 2 cut(s) 76, 86
RsaNI GTAC 2 cut(s) 75, 85
SaqAI TTAA 1 cut(s) 50
SatI GCNGC 1 cut(s) 240
Sau3AI GATC 3 cut(s) 15, 134, 193
Sau96I GGNCC 1 cut(s) 223
SetI ASST 5 cut(s) 36, 50, 117, 159, 241
SinI GGWCC 1 cut(s) 223
SmlI CTYRAG 1 cut(s) 279
SmoI CTYRAG 1 cut(s) 279
SspMI CTAG 1 cut(s) 256
TaqII GACCGA 1 cut(s) 140
TatI WGTACW 1 cut(s) 84
TfiI GAWTC 3 cut(s) 129, 168, 259
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TscAI CASTG 1 cut(s) 25
TseFI GTSAC 1 cut(s) 152
TseI GCWGC 1 cut(s) 239
Tsp45I GTSAC 1 cut(s) 152
TspRI CASTG 1 cut(s) 25
VpaK11BI GGWCC 1 cut(s) 223
XceI RCATGY 1 cut(s) 105
XspI CTAG 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.