Prupe.1G012900_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0001322
Physical Location & Seq
Forward (+)
981494 .. 982472
979 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G012900.2

Sequence Viewer

Length: 225 bp
ATGGGGTGGCTGCACTCCCTCTTCTCTCCTTTGAAGAAGCTGTGGTTTCGTCTCCATTCAGCTCCGAAGAAAACAGGAAGAGGGATATACATTCTGTATGAGGATGTAAAATCCTGCCCCTATGAGGATGTGCATGTCCTGTGGTCAATACTAGTGGAGGCACATACACCTTCTTTGCCATCAAAAAGCATGAGCGAAGGCTCCAATGTTCTTCACAGTATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.45

Weight (kDa)

8.86

Isoelectric Point (pI)

51.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 124
AgsI TTSAA 1 cut(s) 34
AhlI ACTAGT 1 cut(s) 151
AluBI AGCT 2 cut(s) 40, 62
AluI AGCT 2 cut(s) 40, 62
Alw26I GTCTC 1 cut(s) 56
ApeKI GCWGC 1 cut(s) 10
BccI CCATC 1 cut(s) 187
BcoDI GTCTC 1 cut(s) 56
BcuI ACTAGT 1 cut(s) 151
BfaI CTAG 1 cut(s) 152
BisI GCNGC 1 cut(s) 11
BlsI GCNGC 1 cut(s) 12
BmiI GGNNCC 1 cut(s) 202
Bsc4I CCNNNNNNNGG 1 cut(s) 124
BseGI GGATG 2 cut(s) 109, 133
BseLI CCNNNNNNNGG 1 cut(s) 124
BslI CCNNNNNNNGG 1 cut(s) 124
BsmAI GTCTC 1 cut(s) 56
BsmBI CGTCTC 1 cut(s) 56
BspLI GGNNCC 1 cut(s) 202
Bst4CI ACNGT 1 cut(s) 218
Bst6I CTCTTC 2 cut(s) 26, 73
BstF5I GGATG 2 cut(s) 109, 133
BstMAI GTCTC 1 cut(s) 56
BstNSI RCATGY 1 cut(s) 137
BtsCI GGATG 2 cut(s) 109, 133
CspCI CAANNNNNGTGG 2 cut(s) 135, 170
CviAII CATG 2 cut(s) 134, 190
CviJI RGCY 4 cut(s) 10, 40, 62, 201
CviKI_1 RGCY 4 cut(s) 10, 40, 62, 201
Eam1104I CTCTTC 2 cut(s) 26, 73
EarI CTCTTC 2 cut(s) 26, 73
Esp3I CGTCTC 1 cut(s) 56
FaeI CATG 2 cut(s) 137, 193
FaiI YATR 8 cut(s) 88, 99, 123, 135, 165, 191, 221, 223
FatI CATG 2 cut(s) 133, 189
Fnu4HI GCNGC 1 cut(s) 11
FokI GGATG 2 cut(s) 116, 140
Fsp4HI GCNGC 1 cut(s) 11
FspBI CTAG 1 cut(s) 152
GluI GCNGC 1 cut(s) 11
Hin1II CATG 2 cut(s) 137, 193
Hpy188I TCNGA 1 cut(s) 66
HpyAV CCTTC 2 cut(s) 180, 191
HpyCH4III ACNGT 1 cut(s) 218
HpyCH4V TGCA 2 cut(s) 13, 133
Hsp92II CATG 2 cut(s) 137, 193
LmnI GCTCC 2 cut(s) 67, 206
LpnPI CCDG 3 cut(s) 60, 127, 152
MaeI CTAG 1 cut(s) 152
MboII GAAGA 5 cut(s) 13, 46, 79, 90, 203
MnlI CCTC 5 cut(s) 29, 74, 94, 118, 151
NlaIII CATG 2 cut(s) 137, 193
NlaIV GGNNCC 1 cut(s) 202
NspI RCATGY 1 cut(s) 137
PkrI GCNGC 1 cut(s) 12
PspN4I GGNNCC 1 cut(s) 202
SatI GCNGC 1 cut(s) 11
SetI ASST 3 cut(s) 42, 64, 172
SgeI CNNG 6 cut(s) 87, 126, 146, 151, 164, 202
SpeI ACTAGT 1 cut(s) 151
SspMI CTAG 1 cut(s) 152
TaaI ACNGT 1 cut(s) 218
TseI GCWGC 1 cut(s) 10
XceI RCATGY 1 cut(s) 137
XspI CTAG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.