Rmu_sc0001260.1_g000004

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001260.1
Physical Location & Seq
Forward (+)
18201 .. 18936
736 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001260.1_g000004.1.cds

Sequence Viewer

Length: 204 bp
atgggtgggtggcttcagtcgctcttctctcctttgaagaagctctggtttcgcctccattctgctcaaaagaaaagaagagggatatacattctgtatgaggatgtaaaatcatgcccctacgaggatgtgcatgttttgtggtcgatactagtggagtcacatacacatacattgccttctttgccagctcctaaagcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.8

Weight (kDa)

9.52

Isoelectric Point (pI)

80.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 124
AgsI TTSAA 1 cut(s) 37
AhlI ACTAGT 1 cut(s) 151
AluBI AGCT 3 cut(s) 43, 191, 200
AluI AGCT 3 cut(s) 43, 191, 200
BcuI ACTAGT 1 cut(s) 151
BfaI CTAG 1 cut(s) 152
Bsc4I CCNNNNNNNGG 1 cut(s) 124
Bse3DI GCAATG 1 cut(s) 173
BseGI GGATG 2 cut(s) 109, 133
BseLI CCNNNNNNNGG 1 cut(s) 124
BseMI GCAATG 1 cut(s) 173
BslI CCNNNNNNNGG 1 cut(s) 124
BspQI GCTCTTC 1 cut(s) 29
BsrDI GCAATG 1 cut(s) 173
Bst6I CTCTTC 2 cut(s) 29, 73
BstC8I GCNNGC 1 cut(s) 189
BstF5I GGATG 2 cut(s) 109, 133
BstMWI GCNNNNNNNGC 3 cut(s) 19, 184, 197
BstNSI RCATGY 1 cut(s) 137
BtsCI GGATG 2 cut(s) 109, 133
Cac8I GCNNGC 1 cut(s) 189
CviAII CATG 2 cut(s) 114, 134
CviJI RGCY 4 cut(s) 13, 43, 191, 200
CviKI_1 RGCY 4 cut(s) 13, 43, 191, 200
Eam1104I CTCTTC 2 cut(s) 29, 73
EarI CTCTTC 2 cut(s) 29, 73
FaeI CATG 2 cut(s) 117, 137
FaiI YATR 6 cut(s) 88, 99, 115, 135, 165, 171
FatI CATG 2 cut(s) 113, 133
FokI GGATG 2 cut(s) 116, 140
FspBI CTAG 1 cut(s) 152
Hin1II CATG 2 cut(s) 117, 137
HindIII AAGCTT 1 cut(s) 198
HinfI GANTC 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 189
HpyCH4V TGCA 1 cut(s) 133
HpyF10VI GCNNNNNNNGC 3 cut(s) 19, 184, 197
Hsp92II CATG 2 cut(s) 117, 137
LguI GCTCTTC 1 cut(s) 29
LmnI GCTCC 1 cut(s) 196
LpnPI CCDG 1 cut(s) 31
MaeI CTAG 1 cut(s) 152
MaeIII GTNAC 1 cut(s) 159
MboII GAAGA 3 cut(s) 16, 49, 90
MlyI GAGTC 1 cut(s) 167
MnlI CCTC 4 cut(s) 65, 74, 94, 118
MwoI GCNNNNNNNGC 3 cut(s) 19, 184, 197
NlaIII CATG 2 cut(s) 117, 137
NmuCI GTSAC 1 cut(s) 159
NspI RCATGY 1 cut(s) 137
PciSI GCTCTTC 1 cut(s) 29
PleI GAGTC 1 cut(s) 166
PpsI GAGTC 1 cut(s) 166
SapI GCTCTTC 1 cut(s) 29
SchI GAGTC 1 cut(s) 167
SetI ASST 3 cut(s) 45, 193, 202
SgeI CNNG 6 cut(s) 58, 126, 136, 146, 164, 200
SpeI ACTAGT 1 cut(s) 151
SspMI CTAG 1 cut(s) 152
TaqI TCGA 1 cut(s) 146
TseFI GTSAC 1 cut(s) 159
Tsp45I GTSAC 1 cut(s) 159
XceI RCATGY 1 cut(s) 137
XspI CTAG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.