Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp04

Orthogroup ID

OG0001693

Physical Location & Seq

Genomic Coordinates Forward (+)

3175064 .. 3176096

Gene Structure 1033 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.4G066100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 171 bp

ATGGAAATGGCCAATGAGGCTGATGAAGATGGGGAAGGAGAGAGAGAAAAATCCAATACTTGCCAAGAATGTGGTGCTTCTTTTAAGAAACCTGCATATCTCAAGCGACACCTGCAAAGCCATTCCCTCGAGGATTCAACATTTTTAACTACTATCATTTGGATATCGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000182 GO:0003674 GO:0003676 GO:0003677 GO:0003690 GO:0003700 GO:0003723 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0006355 GO:0008097 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0019843 GO:0022613 GO:0031323 GO:0031326 GO:0031974 GO:0031981 GO:0042254 GO:0042273 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043565 GO:0044085 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0070013 GO:0071840 GO:0080084 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1903506 GO:1990837 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR zf-C2H2

Protein Analysis

57

Amino Acids

6.36

Weight (kDa)

4.77

Isoelectric Point (pI)

48.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001693)

Species	Orthologous Gene IDs
malus_domestica	MD15G1186700.v1.1
prunus_persica	Prupe.4G066100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0336331 RchiOBHm_Chr6g0290001 RchiOBHm_Chr7g0227531
rosa_laevigata	RLG00000002888 RLG00000019365
rosa_multiflora	Rmu_sc0000565.1_g000023 Rmu_sc0000776.1_g000047 Rmu_sc0002131.1_g000031 Rmu_sc0002701.1_g000052 Rmu_sc0003318.1_g000004 Rmu_sc0004517.1_g000008 Rmu_sc0004877.1_g000002 Rmu_sc0039095.1_g000001
rosa_roxburghii	Rroxscaffold_1G00033520 Rroxscaffold_1G00040810 Rroxscaffold_1G00040820 Rroxscaffold_2G00107400 Rroxscaffold_2G00116610 Rroxscaffold_3G00224610 Rroxscaffold_4G00304390 Rroxscaffold_4G00304400 Rroxscaffold_4G00315830 Rroxscaffold_5G00346140 Rroxscaffold_5G00380560 Rroxscaffold_6G00389400 Rroxscaffold_7G00183550 Rroxscaffold_7G00205640
rosa_rugosa	Rorug06G0035900
rosa_samantha	Rh1AG116800 Rh2BG425100 Rh2CG611600 Rh2DG432400 Rh3CG233600 Rh4AG247700 Rh4BG058900 Rh4CG156400 Rh5AG268300 Rh5AG485100 Rh5BG239200 Rh5BG398300 Rh6CG191700 Rh7AG359900 Rh7AG382100 Rh7AG403900 Rh7CG188000 Rh7CG378300 Rh7DG395000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	120
AbsI	CCTCGAGG	1 cut(s)	128
Acc36I	ACCTGC	2 cut(s)	100, 120
AcoI	YGGCCR	1 cut(s)	9
AgsI	TTSAA	1 cut(s)	138
Ama87I	CYCGRG	1 cut(s)	128
AoxI	GGCC	1 cut(s)	9
AvaI	CYCGRG	1 cut(s)	128
BalI	TGGCCA	1 cut(s)	11
BccI	CCATC	1 cut(s)	23
BfuAI	ACCTGC	2 cut(s)	100, 120
BglI	GCCNNNNNGGC	1 cut(s)	17
BmeT110I	CYCGRG	1 cut(s)	128
BpuEI	CTTGAG	1 cut(s)	86
BshFI	GGCC	1 cut(s)	11
BsiHKCI	CYCGRG	1 cut(s)	128
BsnI	GGCC	1 cut(s)	11
BsoBI	CYCGRG	1 cut(s)	128
BspANI	GGCC	1 cut(s)	11
BspMI	ACCTGC	2 cut(s)	100, 120
BstMWI	GCNNNNNNNGC	2 cut(s)	17, 112
BstXI	CCANNNNNNTGG	1 cut(s)	71
BsuRI	GGCC	1 cut(s)	11
BveI	ACCTGC	2 cut(s)	100, 120
CviJI	RGCY	3 cut(s)	11, 20, 120
CviKI_1	RGCY	3 cut(s)	11, 20, 120
EaeI	YGGCCR	1 cut(s)	9
Eco32I	GATATC	1 cut(s)	165
Eco88I	CYCGRG	1 cut(s)	128
EcoRV	GATATC	1 cut(s)	165
FaiI	YATR	1 cut(s)	97
HaeIII	GGCC	1 cut(s)	11
HinfI	GANTC	1 cut(s)	134
Hpy188III	TCNNGA	1 cut(s)	168
HpyAV	CCTTC	1 cut(s)	29
HpyCH4V	TGCA	2 cut(s)	95, 115
HpyF10VI	GCNNNNNNNGC	2 cut(s)	17, 112
LpnPI	CCDG	2 cut(s)	105, 125
MboII	GAAGA	1 cut(s)	38
MlsI	TGGCCA	1 cut(s)	11
MluNI	TGGCCA	1 cut(s)	11
MnlI	CCTC	3 cut(s)	10, 124, 137
Mox20I	TGGCCA	1 cut(s)	11
MscI	TGGCCA	1 cut(s)	11
MseI	TTAA	2 cut(s)	84, 146
Msp20I	TGGCCA	1 cut(s)	11
MwoI	GCNNNNNNNGC	2 cut(s)	17, 112
PaeR7I	CTCGAG	1 cut(s)	128
PaqCI	CACCTGC	1 cut(s)	120
PfeI	GAWTC	1 cut(s)	134
PspXI	VCTCGAGB	1 cut(s)	128
SaqAI	TTAA	2 cut(s)	84, 146
SetI	ASST	2 cut(s)	94, 114
Sfr274I	CTCGAG	1 cut(s)	128
SgeI	CNNG	7 cut(s)	72, 77, 104, 115, 124, 140, 142
SlaI	CTCGAG	1 cut(s)	128
SmlI	CTYRAG	2 cut(s)	101, 128
SmoI	CTYRAG	2 cut(s)	101, 128
TaqI	TCGA	1 cut(s)	129
TfiI	GAWTC	1 cut(s)	134
Tru1I	TTAA	2 cut(s)	84, 146
Tru9I	TTAA	2 cut(s)	84, 146
TspDTI	ATGAA	1 cut(s)	39
XhoI	CTCGAG	1 cut(s)	128

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.