Rh1AG116800

Zinc finger protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
20077673 .. 20080275
2603 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG116800.1

Sequence Viewer

Length: 222 bp
ATGGAAATGGCAAAGGCTGGTGGGGAAGTTGTGGTGGAGAAGTCTAATACATATGAAGAATGTGGTGCTAGTTTTAAGAAACCTGCGTATCTCAAGAAGCATATGCAAAGCCATTCTCCTGAGGAAACTCTAGAAGCTGAGATCAAGATGCTCAGGAAGAAGTTGACCTTTAAAGCAATTACAATGCCTAACGCTGATCCTCCTCCTAATATCTCTAAGTAG

Protein Analysis

73

Amino Acids

8.17

Weight (kDa)

8.73

Isoelectric Point (pI)

58.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPX2 PF06886 36 - 69 3.4e-06 Targeting protein for Xklp2 (TPX2) domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 91
AclWI GGATC 1 cut(s) 191
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
AlwI GGATC 1 cut(s) 191
AxyI CCTNAGG 1 cut(s) 120
BaeI ACNNNNGTAYC 2 cut(s) 71, 104
BfaI CTAG 2 cut(s) 69, 131
BfuAI ACCTGC 1 cut(s) 91
BmsI GCATC 1 cut(s) 138
Bpu10I CCTNAGC 1 cut(s) 152
BpuEI CTTGAG 1 cut(s) 77
Bse21I CCTNAGG 1 cut(s) 120
BseMII CTCAG 3 cut(s) 111, 129, 166
BseRI GAGGAG 1 cut(s) 192
Bsp143I GATC 2 cut(s) 141, 196
BspCNI CTCAG 3 cut(s) 112, 130, 165
BspMI ACCTGC 1 cut(s) 91
BspPI GGATC 1 cut(s) 191
BssMI GATC 2 cut(s) 141, 196
BstDEI CTNAG 4 cut(s) 120, 138, 152, 216
BstKTI GATC 2 cut(s) 144, 199
BstMBI GATC 2 cut(s) 141, 196
Bsu36I CCTNAGG 1 cut(s) 120
BveI ACCTGC 1 cut(s) 91
CviJI RGCY 3 cut(s) 17, 111, 137
CviKI_1 RGCY 3 cut(s) 17, 111, 137
DdeI CTNAG 4 cut(s) 120, 138, 152, 216
DpnI GATC 2 cut(s) 143, 198
DpnII GATC 2 cut(s) 141, 196
DraI TTTAAA 1 cut(s) 172
Eco81I CCTNAGG 1 cut(s) 120
FaiI YATR 4 cut(s) 52, 54, 102, 104
FalI AAGNNNNNCTT 2 cut(s) 152, 184
FauNDI CATATG 2 cut(s) 52, 102
FspBI CTAG 2 cut(s) 69, 131
HincII GTYRAC 1 cut(s) 165
HindII GTYRAC 1 cut(s) 165
Hpy166II GTNNAC 1 cut(s) 165
Hpy188III TCNNGA 5 cut(s) 94, 119, 131, 145, 154
Hpy8I GTNNAC 1 cut(s) 165
HpyCH4V TGCA 1 cut(s) 106
HpyF3I CTNAG 4 cut(s) 120, 138, 152, 216
Kzo9I GATC 2 cut(s) 141, 196
LpnPI CCDG 4 cut(s) 3, 96, 132, 139
LweI GCATC 1 cut(s) 138
MaeI CTAG 2 cut(s) 69, 131
MalI GATC 2 cut(s) 143, 198
MboI GATC 2 cut(s) 141, 196
MboII GAAGA 2 cut(s) 68, 169
MluCI AATT 1 cut(s) 177
MnlI CCTC 3 cut(s) 115, 210, 213
MseI TTAA 2 cut(s) 75, 171
NdeI CATATG 2 cut(s) 52, 102
NdeII GATC 2 cut(s) 141, 196
SaqAI TTAA 2 cut(s) 75, 171
Sau3AI GATC 2 cut(s) 141, 196
SetI ASST 3 cut(s) 85, 139, 170
SfaNI GCATC 1 cut(s) 138
SgeI CNNG 8 cut(s) 30, 81, 95, 106, 131, 143, 157, 166
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 1 cut(s) 177
SspMI CTAG 2 cut(s) 69, 131
TasI AATT 1 cut(s) 177
Tru1I TTAA 2 cut(s) 75, 171
Tru9I TTAA 2 cut(s) 75, 171
TspDTI ATGAA 1 cut(s) 69
XbaI TCTAGA 1 cut(s) 130
XspI CTAG 2 cut(s) 69, 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.