Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004517.1

Orthogroup ID

OG0001693

Physical Location & Seq

Genomic Coordinates Reverse (-)

39397 .. 39760

Gene Structure 364 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004517.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 213 bp

atggaggaagctgaagccgagatggaggtgcctacttgcagggacattaggcgctattactgcgattactgtggcatctgcaggtccaaaaagtccctcattgcttctcacgtcctcacccaccacaaggacgagagggatatggccgaggctaatggagatggcgattcagaagttgagaaagtccaatacttgccaggaatgtgggcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000182 GO:0003674 GO:0003676 GO:0003677 GO:0003690 GO:0003700 GO:0003723 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0006355 GO:0008097 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0019843 GO:0022613 GO:0031323 GO:0031326 GO:0031974 GO:0031981 GO:0042254 GO:0042273 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043565 GO:0044085 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0070013 GO:0071840 GO:0080084 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1903506 GO:1990837 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR zf-C2H2

Protein Analysis

70

Amino Acids

8.07

Weight (kDa)

4.88

Isoelectric Point (pI)

40.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001693)

Species	Orthologous Gene IDs
malus_domestica	MD15G1186700.v1.1
prunus_persica	Prupe.4G066100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0336331 RchiOBHm_Chr6g0290001 RchiOBHm_Chr7g0227531
rosa_laevigata	RLG00000002888 RLG00000019365
rosa_multiflora	Rmu_sc0000565.1_g000023 Rmu_sc0000776.1_g000047 Rmu_sc0002131.1_g000031 Rmu_sc0002701.1_g000052 Rmu_sc0003318.1_g000004 Rmu_sc0004517.1_g000008 Rmu_sc0004877.1_g000002 Rmu_sc0039095.1_g000001
rosa_roxburghii	Rroxscaffold_1G00033520 Rroxscaffold_1G00040810 Rroxscaffold_1G00040820 Rroxscaffold_2G00107400 Rroxscaffold_2G00116610 Rroxscaffold_3G00224610 Rroxscaffold_4G00304390 Rroxscaffold_4G00304400 Rroxscaffold_4G00315830 Rroxscaffold_5G00346140 Rroxscaffold_5G00380560 Rroxscaffold_6G00389400 Rroxscaffold_7G00183550 Rroxscaffold_7G00205640
rosa_rugosa	Rorug06G0035900
rosa_samantha	Rh1AG116800 Rh2BG425100 Rh2CG611600 Rh2DG432400 Rh3CG233600 Rh4AG247700 Rh4BG058900 Rh4CG156400 Rh5AG268300 Rh5AG485100 Rh5BG239200 Rh5BG398300 Rh6CG191700 Rh7AG359900 Rh7AG382100 Rh7AG403900 Rh7CG188000 Rh7CG378300 Rh7DG395000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	72
AccB1I	GGYRCC	1 cut(s)	28
AcoI	YGGCCR	1 cut(s)	144
AcuI	CTGAAG	1 cut(s)	33
AfiI	CCNNNNNNNGG	1 cut(s)	127
AjiI	CACGTC	1 cut(s)	112
AjnI	CCWGG	1 cut(s)	196
AluBI	AGCT	1 cut(s)	11
AluI	AGCT	1 cut(s)	11
AoxI	GGCC	1 cut(s)	144
AspLEI	GCGC	1 cut(s)	54
AspS9I	GGNCC	1 cut(s)	84
AsuHPI	GGTGA	1 cut(s)	109
AvaII	GGWCC	1 cut(s)	84
BanI	GGYRCC	1 cut(s)	28
BccI	CCATC	2 cut(s)	16, 155
BciT130I	CCWGG	1 cut(s)	198
BfmI	CTRYAG	1 cut(s)	79
BfoI	RGCGCY	1 cut(s)	55
BfuAI	ACCTGC	1 cut(s)	72
Bme1390I	CCNGG	1 cut(s)	198
Bme18I	GGWCC	1 cut(s)	84
BmgBI	CACGTC	1 cut(s)	112
BmgT120I	GGNCC	1 cut(s)	84
BmiI	GGNNCC	1 cut(s)	30
BmrFI	CCNGG	1 cut(s)	198
BmsI	GCATC	1 cut(s)	84
BsaJI	CCNNGG	1 cut(s)	147
Bsc4I	CCNNNNNNNGG	1 cut(s)	127
Bse3DI	GCAATG	1 cut(s)	99
BseBI	CCWGG	1 cut(s)	198
BseDI	CCNNGG	1 cut(s)	147
BseLI	CCNNNNNNNGG	1 cut(s)	127
BseMI	GCAATG	1 cut(s)	99
BshFI	GGCC	1 cut(s)	146
BshNI	GGYRCC	1 cut(s)	28
BslFI	GGGAC	2 cut(s)	56, 79
BslI	CCNNNNNNNGG	1 cut(s)	127
BsmFI	GGGAC	2 cut(s)	56, 79
BsnI	GGCC	1 cut(s)	146
BspANI	GGCC	1 cut(s)	146
BspLI	GGNNCC	1 cut(s)	30
BspMAI	CTGCAG	1 cut(s)	83
BspMI	ACCTGC	1 cut(s)	72
BspT107I	GGYRCC	1 cut(s)	28
BsrDI	GCAATG	1 cut(s)	99
BssECI	CCNNGG	1 cut(s)	147
Bst2UI	CCWGG	1 cut(s)	198
Bst4CI	ACNGT	1 cut(s)	71
BstDEI	CTNAG	1 cut(s)	210
BstH2I	RGCGCY	1 cut(s)	55
BstHHI	GCGC	1 cut(s)	54
BstMWI	GCNNNNNNNGC	1 cut(s)	60
BstNI	CCWGG	1 cut(s)	198
BstSCI	CCNGG	1 cut(s)	196
BstSFI	CTRYAG	1 cut(s)	79
BstXI	CCANNNNNNTGG	1 cut(s)	204
BsuRI	GGCC	1 cut(s)	146
BtrI	CACGTC	1 cut(s)	112
BveI	ACCTGC	1 cut(s)	72
CfoI	GCGC	1 cut(s)	54
Cfr13I	GGNCC	1 cut(s)	84
CviJI	RGCY	5 cut(s)	11, 17, 146, 152, 209
CviKI_1	RGCY	5 cut(s)	11, 17, 146, 152, 209
DdeI	CTNAG	1 cut(s)	210
EaeI	YGGCCR	1 cut(s)	144
Eco47I	GGWCC	1 cut(s)	84
Eco57I	CTGAAG	1 cut(s)	33
EcoRII	CCWGG	1 cut(s)	196
FaiI	YATR	1 cut(s)	143
FaqI	GGGAC	2 cut(s)	56, 79
GlaI	GCGC	1 cut(s)	53
HaeII	RGCGCY	1 cut(s)	55
HaeIII	GGCC	1 cut(s)	146
HhaI	GCGC	1 cut(s)	54
Hin6I	GCGC	1 cut(s)	52
HinP1I	GCGC	1 cut(s)	52
HinfI	GANTC	1 cut(s)	167
HphI	GGTGA	1 cut(s)	109
Hpy188I	TCNGA	1 cut(s)	172
HpyCH4III	ACNGT	1 cut(s)	71
HpyCH4IV	ACGT	1 cut(s)	111
HpyCH4V	TGCA	2 cut(s)	39, 81
HpyF10VI	GCNNNNNNNGC	1 cut(s)	60
HpyF3I	CTNAG	1 cut(s)	210
HpySE526I	ACGT	1 cut(s)	111
HspAI	GCGC	1 cut(s)	52
LpnPI	CCDG	3 cut(s)	25, 67, 183
LweI	GCATC	1 cut(s)	84
MaeII	ACGT	1 cut(s)	111
MnlI	CCTC	5 cut(s)	19, 107, 125, 129, 142
MspR9I	CCNGG	1 cut(s)	198
MvaI	CCWGG	1 cut(s)	198
MwoI	GCNNNNNNNGC	1 cut(s)	60
NlaIV	GGNNCC	1 cut(s)	30
NmeAIII	GCCGAG	2 cut(s)	43, 172
PfeI	GAWTC	1 cut(s)	167
Psp6I	CCWGG	1 cut(s)	196
PspGI	CCWGG	1 cut(s)	196
PspN4I	GGNNCC	1 cut(s)	30
PspPI	GGNCC	1 cut(s)	84
PstI	CTGCAG	1 cut(s)	83
Sau96I	GGNCC	1 cut(s)	84
ScrFI	CCNGG	1 cut(s)	198
SetI	ASST	4 cut(s)	13, 30, 86, 114
SfaNI	GCATC	1 cut(s)	84
SfcI	CTRYAG	1 cut(s)	79
SinI	GGWCC	1 cut(s)	84
StyD4I	CCNGG	1 cut(s)	196
TaaI	ACNGT	1 cut(s)	71
TaiI	ACGT	1 cut(s)	114
TfiI	GAWTC	1 cut(s)	167
VpaK11BI	GGWCC	1 cut(s)	84

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.