Rroxscaffold_4G00304390

Zinc finger protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
25069409 .. 25071177
1769 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00304390.1

Sequence Viewer

Length: 162 bp
ATGGAAATGGCAAAGGCTAGTGAGGAAGTTGTGGTGGAGAATTCTAATACATGTGAAGAATGTGGTGCTAGTTTCAAGAAACTCGAATATCTCAAGCGGCATATGCAAAGCCATTCTCTTGAGGTAGGAGATATTGAAGGTGATGCCCCATCAGCTAAGTGA

Protein Analysis

53

Amino Acids

5.84

Weight (kDa)

4.8

Isoelectric Point (pI)

57.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-C2H2 PF00096 17 - 38 4.5e-06 Zinc finger, C2H2 type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 97
AcsI RAATTY 1 cut(s) 40
AflIII ACRYGT 1 cut(s) 50
AgsI TTSAA 2 cut(s) 76, 137
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
ApoI RAATTY 1 cut(s) 40
AsuHPI GGTGA 1 cut(s) 152
BccI CCATC 1 cut(s) 157
BfaI CTAG 2 cut(s) 18, 69
BisI GCNGC 1 cut(s) 98
BlsI GCNGC 1 cut(s) 99
BmsI GCATC 1 cut(s) 133
BpuEI CTTGAG 2 cut(s) 77, 140
BspACI CCGC 1 cut(s) 97
BstDEI CTNAG 1 cut(s) 156
BstMWI GCNNNNNNNGC 2 cut(s) 103, 152
BstNSI RCATGY 1 cut(s) 54
CviAII CATG 1 cut(s) 51
CviJI RGCY 3 cut(s) 17, 111, 155
CviKI_1 RGCY 3 cut(s) 17, 111, 155
DdeI CTNAG 1 cut(s) 156
EcoRI GAATTC 1 cut(s) 40
FaeI CATG 1 cut(s) 54
FaiI YATR 3 cut(s) 52, 102, 104
FatI CATG 1 cut(s) 50
FauNDI CATATG 1 cut(s) 102
Fnu4HI GCNGC 1 cut(s) 98
Fsp4HI GCNGC 1 cut(s) 98
FspBI CTAG 2 cut(s) 18, 69
FspEI CC 9 cut(s) 8, 17, 20, 48, 82, 107, 111, 123, 125
GluI GCNGC 1 cut(s) 98
Hin1II CATG 1 cut(s) 54
HphI GGTGA 1 cut(s) 152
Hpy188III TCNNGA 2 cut(s) 76, 119
HpyAV CCTTC 1 cut(s) 131
HpyCH4V TGCA 1 cut(s) 106
HpyF10VI GCNNNNNNNGC 2 cut(s) 103, 152
HpyF3I CTNAG 1 cut(s) 156
Hsp92II CATG 1 cut(s) 54
LweI GCATC 1 cut(s) 133
MaeI CTAG 2 cut(s) 18, 69
MboII GAAGA 1 cut(s) 68
MluCI AATT 1 cut(s) 40
MnlI CCTC 2 cut(s) 16, 115
MwoI GCNNNNNNNGC 2 cut(s) 103, 152
NdeI CATATG 1 cut(s) 102
NlaIII CATG 1 cut(s) 54
NspI RCATGY 1 cut(s) 54
PciI ACATGT 1 cut(s) 50
PkrI GCNGC 1 cut(s) 99
PscI ACATGT 1 cut(s) 50
SatI GCNGC 1 cut(s) 98
SetI ASST 3 cut(s) 126, 142, 157
SfaNI GCATC 1 cut(s) 133
SgeI CNNG 7 cut(s) 30, 63, 81, 88, 95, 106, 131
SmlI CTYRAG 2 cut(s) 92, 119
SmoI CTYRAG 2 cut(s) 92, 119
Sse9I AATT 1 cut(s) 40
SsiI CCGC 1 cut(s) 97
SspMI CTAG 2 cut(s) 18, 69
TaqI TCGA 1 cut(s) 84
TasI AATT 1 cut(s) 40
TauI GCSGC 1 cut(s) 100
XapI RAATTY 1 cut(s) 40
XceI RCATGY 1 cut(s) 54
XspI CTAG 2 cut(s) 18, 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.