Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5A

Orthogroup ID

OG0001693

Physical Location & Seq

Genomic Coordinates Reverse (-)

35417509 .. 35427625

Gene Structure 10117 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5AG268300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 168 bp

ATGGAAATGGCAAAGGCTGGTGGGGAAGTTGTGGTGGAGAAGTCTAATACATGTGAAGAATGTGGTGCTAGTTTCAAGAAACCTGCATATCTCAAGAAGCGTATGCAAAGCCATTCTCCTGAGATTCATGACAAGTTAAAAGGAGCTACAGTCAATATTAAAATTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000182 GO:0003674 GO:0003676 GO:0003677 GO:0003690 GO:0003700 GO:0003723 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0006355 GO:0008097 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0019843 GO:0022613 GO:0031323 GO:0031326 GO:0031974 GO:0031981 GO:0042254 GO:0042273 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043565 GO:0044085 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0070013 GO:0071840 GO:0080084 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1903506 GO:1990837 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR zf-C2H2

Protein Analysis

55

Amino Acids

6.05

Weight (kDa)

9.03

Isoelectric Point (pI)

48.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001693)

Species	Orthologous Gene IDs
malus_domestica	MD15G1186700.v1.1
prunus_persica	Prupe.4G066100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0336331 RchiOBHm_Chr6g0290001 RchiOBHm_Chr7g0227531
rosa_laevigata	RLG00000002888 RLG00000019365
rosa_multiflora	Rmu_sc0000565.1_g000023 Rmu_sc0000776.1_g000047 Rmu_sc0002131.1_g000031 Rmu_sc0002701.1_g000052 Rmu_sc0003318.1_g000004 Rmu_sc0004517.1_g000008 Rmu_sc0004877.1_g000002 Rmu_sc0039095.1_g000001
rosa_roxburghii	Rroxscaffold_1G00033520 Rroxscaffold_1G00040810 Rroxscaffold_1G00040820 Rroxscaffold_2G00107400 Rroxscaffold_2G00116610 Rroxscaffold_3G00224610 Rroxscaffold_4G00304390 Rroxscaffold_4G00304400 Rroxscaffold_4G00315830 Rroxscaffold_5G00346140 Rroxscaffold_5G00380560 Rroxscaffold_6G00389400 Rroxscaffold_7G00183550 Rroxscaffold_7G00205640
rosa_rugosa	Rorug06G0035900
rosa_samantha	Rh1AG116800 Rh2BG425100 Rh2CG611600 Rh2DG432400 Rh3CG233600 Rh4AG247700 Rh4BG058900 Rh4CG156400 Rh5AG268300 Rh5AG485100 Rh5BG239200 Rh5BG398300 Rh6CG191700 Rh7AG359900 Rh7AG382100 Rh7AG403900 Rh7CG188000 Rh7CG378300 Rh7DG395000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	91
AcsI	RAATTY	1 cut(s)	162
AflIII	ACRYGT	1 cut(s)	50
AgsI	TTSAA	1 cut(s)	76
AluBI	AGCT	1 cut(s)	146
AluI	AGCT	1 cut(s)	146
ApoI	RAATTY	1 cut(s)	162
BfaI	CTAG	1 cut(s)	69
BfmI	CTRYAG	1 cut(s)	147
BfuAI	ACCTGC	1 cut(s)	91
BpuEI	CTTGAG	1 cut(s)	77
BsaXI	ACNNNNNCTCC	2 cut(s)	135, 165
BseMII	CTCAG	1 cut(s)	111
BspCNI	CTCAG	1 cut(s)	112
BspHI	TCATGA	1 cut(s)	127
BspMI	ACCTGC	1 cut(s)	91
Bst4CI	ACNGT	1 cut(s)	151
BstDEI	CTNAG	1 cut(s)	120
BstNSI	RCATGY	1 cut(s)	54
BstSFI	CTRYAG	1 cut(s)	147
BveI	ACCTGC	1 cut(s)	91
CciI	TCATGA	1 cut(s)	127
CviAII	CATG	2 cut(s)	51, 128
CviJI	RGCY	3 cut(s)	17, 111, 146
CviKI_1	RGCY	3 cut(s)	17, 111, 146
DdeI	CTNAG	1 cut(s)	120
FaeI	CATG	2 cut(s)	54, 131
FaiI	YATR	4 cut(s)	52, 88, 104, 129
FatI	CATG	2 cut(s)	50, 127
FspBI	CTAG	1 cut(s)	69
Hin1II	CATG	2 cut(s)	54, 131
HinfI	GANTC	1 cut(s)	124
Hpy188III	TCNNGA	4 cut(s)	76, 94, 119, 128
HpyCH4III	ACNGT	1 cut(s)	151
HpyCH4V	TGCA	2 cut(s)	86, 106
HpyF3I	CTNAG	1 cut(s)	120
Hsp92II	CATG	2 cut(s)	54, 131
LmnI	GCTCC	1 cut(s)	143
LpnPI	CCDG	3 cut(s)	3, 96, 132
MaeI	CTAG	1 cut(s)	69
MboII	GAAGA	1 cut(s)	68
MluCI	AATT	1 cut(s)	162
MseI	TTAA	2 cut(s)	137, 159
NlaIII	CATG	2 cut(s)	54, 131
NspI	RCATGY	1 cut(s)	54
PagI	TCATGA	1 cut(s)	127
PciI	ACATGT	1 cut(s)	50
PfeI	GAWTC	1 cut(s)	124
PscI	ACATGT	1 cut(s)	50
SaqAI	TTAA	2 cut(s)	137, 159
SetI	ASST	2 cut(s)	85, 148
SfcI	CTRYAG	1 cut(s)	147
SgeI	CNNG	9 cut(s)	30, 63, 81, 88, 95, 106, 131, 140, 145
SmlI	CTYRAG	1 cut(s)	92
SmoI	CTYRAG	1 cut(s)	92
Sse9I	AATT	1 cut(s)	162
SspI	AATATT	1 cut(s)	157
SspMI	CTAG	1 cut(s)	69
TaaI	ACNGT	1 cut(s)	151
TasI	AATT	1 cut(s)	162
TfiI	GAWTC	1 cut(s)	124
Tru1I	TTAA	2 cut(s)	137, 159
Tru9I	TTAA	2 cut(s)	137, 159
TspDTI	ATGAA	1 cut(s)	116
XapI	RAATTY	1 cut(s)	162
XceI	RCATGY	1 cut(s)	54
XspI	CTAG	1 cut(s)	69

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.