Prupe.4G231200_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
OG0001391
Physical Location & Seq
Reverse (-)
14817882 .. 14818933
1052 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G231200.1

Sequence Viewer

Length: 432 bp
ATGGAGTCTCGTTCTTACATGACTTGTGGAGTGAAAATTGACACGAATTCGGATGGATGGCATAAGTGCCTGACTAAAATGCTGAAAAAAATCCAAGGTGCATCTTATAATGTAGATGCAGAAGGAGGCATGGCATATGTTTCTGGGAAAGTAAACCCTAGGAAGCTAATAAGAAGGCTAGTGAAGGCTGGGAAAGAAGCAGAACTCTGCTGGGTAAGAACTGGAGATGAATTTACATATGGCAATGGATATTATGAAGACCAGAGATATTATGATCCCAGCAGTAACTACATGGGATTAACAGCAGGCCCTAATTACTATAATATGAATGGTAATTATGGACATGGATATTATTCTTCATACAGCCACCACCATGGACATCCTATGAACAATTACTATCCACAGGCGCCATATTCATATAATTATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

144

Amino Acids

16.5

Weight (kDa)

8.61

Isoelectric Point (pI)

33.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 108
AccB1I GGYRCC 1 cut(s) 406
AclWI GGATC 1 cut(s) 269
AcsI RAATTY 2 cut(s) 46, 230
AcyI GRCGYC 1 cut(s) 407
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
Alw26I GTCTC 1 cut(s) 12
AlwI GGATC 1 cut(s) 269
AoxI GGCC 1 cut(s) 307
ApoI RAATTY 2 cut(s) 46, 230
AspA2I CCTAGG 1 cut(s) 158
AspLEI GCGC 1 cut(s) 409
AspS9I GGNCC 1 cut(s) 308
AvrII CCTAGG 1 cut(s) 158
BanI GGYRCC 1 cut(s) 406
BbsI GAAGAC 1 cut(s) 264
BccI CCATC 2 cut(s) 47, 51
BcoDI GTCTC 1 cut(s) 12
BfaI CTAG 2 cut(s) 159, 179
BfoI RGCGCY 1 cut(s) 410
BlnI CCTAGG 1 cut(s) 158
BmgT120I GGNCC 1 cut(s) 308
BmiI GGNNCC 1 cut(s) 408
BmsI GCATC 2 cut(s) 106, 110
BpiI GAAGAC 1 cut(s) 264
BpmI CTGGAG 1 cut(s) 243
BsaHI GRCGYC 1 cut(s) 407
BsaJI CCNNGG 3 cut(s) 94, 158, 373
Bse1I ACTGG 1 cut(s) 226
Bse3DI GCAATG 1 cut(s) 250
BseDI CCNNGG 3 cut(s) 94, 158, 373
BseGI GGATG 3 cut(s) 58, 62, 379
BseMI GCAATG 1 cut(s) 250
BseNI ACTGG 1 cut(s) 226
BseYI CCCAGC 3 cut(s) 188, 210, 278
BshFI GGCC 1 cut(s) 309
BshNI GGYRCC 1 cut(s) 406
BsmAI GTCTC 1 cut(s) 12
BsnI GGCC 1 cut(s) 309
Bsp143I GATC 1 cut(s) 274
Bsp19I CCATGG 1 cut(s) 373
BspANI GGCC 1 cut(s) 309
BspLI GGNNCC 1 cut(s) 408
BspPI GGATC 1 cut(s) 269
BspT107I GGYRCC 1 cut(s) 406
BsrDI GCAATG 1 cut(s) 250
BsrI ACTGG 1 cut(s) 226
BssECI CCNNGG 3 cut(s) 94, 158, 373
BssMI GATC 1 cut(s) 274
BssNI GRCGYC 1 cut(s) 407
BssT1I CCWWGG 3 cut(s) 94, 158, 373
BstACI GRCGYC 1 cut(s) 407
BstC8I GCNNGC 1 cut(s) 307
BstDSI CCRYGG 1 cut(s) 373
BstF5I GGATG 3 cut(s) 58, 62, 379
BstH2I RGCGCY 1 cut(s) 410
BstHHI GCGC 1 cut(s) 409
BstKTI GATC 1 cut(s) 277
BstMAI GTCTC 1 cut(s) 12
BstMBI GATC 1 cut(s) 274
BstV2I GAAGAC 1 cut(s) 264
BstXI CCANNNNNNTGG 1 cut(s) 374
BsuRI GGCC 1 cut(s) 309
BtgI CCRYGG 1 cut(s) 373
BtsCI GGATG 3 cut(s) 58, 62, 379
Cac8I GCNNGC 1 cut(s) 307
CfoI GCGC 1 cut(s) 409
Cfr13I GGNCC 1 cut(s) 308
CviAII CATG 5 cut(s) 19, 130, 292, 344, 374
CviJI RGCY 5 cut(s) 166, 178, 188, 309, 366
CviKI_1 RGCY 5 cut(s) 166, 178, 188, 309, 366
DinI GGCGCC 1 cut(s) 408
DpnI GATC 1 cut(s) 276
DpnII GATC 1 cut(s) 274
Eco130I CCWWGG 3 cut(s) 94, 158, 373
EcoO109I RGGNCCY 1 cut(s) 308
EcoRI GAATTC 1 cut(s) 46
EcoT14I CCWWGG 3 cut(s) 94, 158, 373
EgeI GGCGCC 1 cut(s) 408
EheI GGCGCC 1 cut(s) 408
ErhI CCWWGG 3 cut(s) 94, 158, 373
FaeI CATG 5 cut(s) 22, 133, 295, 347, 377
FatI CATG 5 cut(s) 18, 129, 291, 343, 373
FauNDI CATATG 2 cut(s) 136, 238
FokI GGATG 3 cut(s) 65, 69, 366
FspBI CTAG 2 cut(s) 159, 179
GlaI GCGC 1 cut(s) 408
GsaI CCCAGC 3 cut(s) 192, 214, 282
GsuI CTGGAG 1 cut(s) 243
HaeII RGCGCY 1 cut(s) 410
HaeIII GGCC 1 cut(s) 309
HhaI GCGC 1 cut(s) 409
Hin1I GRCGYC 1 cut(s) 407
Hin1II CATG 5 cut(s) 22, 133, 295, 347, 377
Hin6I GCGC 1 cut(s) 407
HinP1I GCGC 1 cut(s) 407
HinfI GANTC 1 cut(s) 5
Hpy166II GTNNAC 1 cut(s) 154
Hpy188I TCNGA 1 cut(s) 52
Hpy8I GTNNAC 1 cut(s) 154
HpyAV CCTTC 3 cut(s) 116, 168, 178
HpyCH4V TGCA 2 cut(s) 101, 119
Hsp92I GRCGYC 1 cut(s) 407
Hsp92II CATG 5 cut(s) 22, 133, 295, 347, 377
HspAI GCGC 1 cut(s) 407
KasI GGCGCC 1 cut(s) 406
Kzo9I GATC 1 cut(s) 274
LpnPI CCDG 9 cut(s) 83, 129, 174, 196, 207, 275, 291, 292, 389
LweI GCATC 2 cut(s) 106, 110
MaeI CTAG 2 cut(s) 159, 179
MaeIII GTNAC 1 cut(s) 284
MalI GATC 1 cut(s) 276
MboI GATC 1 cut(s) 274
MboII GAAGA 2 cut(s) 269, 348
MluCI AATT 7 cut(s) 36, 46, 230, 313, 334, 391, 421
Mly113I GGCGCC 1 cut(s) 407
MlyI GAGTC 1 cut(s) 14
MnlI CCTC 1 cut(s) 119
MseI TTAA 1 cut(s) 299
MslI CAYNNNNRTG 1 cut(s) 372
NarI GGCGCC 1 cut(s) 407
NcoI CCATGG 1 cut(s) 373
NdeI CATATG 2 cut(s) 136, 238
NdeII GATC 1 cut(s) 274
NlaIII CATG 5 cut(s) 22, 133, 295, 347, 377
NlaIV GGNNCC 1 cut(s) 408
PleI GAGTC 1 cut(s) 13
PluTI GGCGCC 1 cut(s) 410
PpsI GAGTC 1 cut(s) 13
PsiI TTATAA 1 cut(s) 108
PspFI CCCAGC 3 cut(s) 188, 210, 278
PspN4I GGNNCC 1 cut(s) 408
PspPI GGNCC 1 cut(s) 308
RseI CAYNNNNRTG 1 cut(s) 372
SaqAI TTAA 1 cut(s) 299
Sau3AI GATC 1 cut(s) 274
Sau96I GGNCC 1 cut(s) 308
SchI GAGTC 1 cut(s) 14
SetI ASST 2 cut(s) 100, 168
SfaNI GCATC 2 cut(s) 106, 110
SfoI GGCGCC 1 cut(s) 408
SmiMI CAYNNNNRTG 1 cut(s) 372
Sse9I AATT 7 cut(s) 36, 46, 230, 313, 334, 391, 421
SspDI GGCGCC 1 cut(s) 406
SspMI CTAG 2 cut(s) 159, 179
StyI CCWWGG 3 cut(s) 94, 158, 373
TasI AATT 7 cut(s) 36, 46, 230, 313, 334, 391, 421
Tru1I TTAA 1 cut(s) 299
Tru9I TTAA 1 cut(s) 299
TspDTI ATGAA 6 cut(s) 243, 270, 341, 348, 401, 405
XapI RAATTY 2 cut(s) 46, 230
XmaJI CCTAGG 1 cut(s) 158
XspI CTAG 2 cut(s) 159, 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.