RchiOBHm_Chr5g0042401

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
37165356 .. 37166574
1219 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32080

Sequence Viewer

Length: 204 bp
ATGACTTATGAACTCGGTCAGCCATCTCTATGGAGCTGTCTACTGAAAGTTGACACGCAATCTGGTGGATGGGAAAAGTGCCTGACCAAGATGCTGAAAAAAATCAGAGGTATAGTTACACTATTATTCTTCACTATGCATCCATCCATGTCTTCTTTTTTTATTCGTAAAAACCTAGGAAAAATTTATTTCCCATCTCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.75

Weight (kDa)

9.76

Isoelectric Point (pI)

51.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 40
AcsI RAATTY 1 cut(s) 183
AluBI AGCT 1 cut(s) 36
AluI AGCT 1 cut(s) 36
ApoI RAATTY 1 cut(s) 183
AspA2I CCTAGG 1 cut(s) 175
AvrII CCTAGG 1 cut(s) 175
BbsI GAAGAC 1 cut(s) 144
BccI CCATC 4 cut(s) 31, 63, 151, 202
BfaI CTAG 1 cut(s) 176
BlnI CCTAGG 1 cut(s) 175
BmsI GCATC 2 cut(s) 81, 148
BpiI GAAGAC 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 175
BseDI CCNNGG 1 cut(s) 175
BseGI GGATG 3 cut(s) 74, 139, 143
BssECI CCNNGG 1 cut(s) 175
BssT1I CCWWGG 1 cut(s) 175
BstF5I GGATG 3 cut(s) 74, 139, 143
BstV2I GAAGAC 1 cut(s) 144
BstXI CCANNNNNNTGG 1 cut(s) 30
BtsCI GGATG 3 cut(s) 74, 139, 143
CviAII CATG 1 cut(s) 148
CviJI RGCY 2 cut(s) 22, 36
CviKI_1 RGCY 2 cut(s) 22, 36
Eco130I CCWWGG 1 cut(s) 175
EcoT14I CCWWGG 1 cut(s) 175
EcoT22I ATGCAT 1 cut(s) 141
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 1 cut(s) 151
FaiI YATR 5 cut(s) 9, 31, 113, 137, 149
FatI CATG 1 cut(s) 147
FblI GTMKAC 1 cut(s) 40
FokI GGATG 3 cut(s) 81, 126, 130
FspBI CTAG 1 cut(s) 176
Hin1II CATG 1 cut(s) 151
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
Hpy166II GTNNAC 2 cut(s) 41, 52
Hpy188I TCNGA 1 cut(s) 107
Hpy8I GTNNAC 2 cut(s) 41, 52
HpyCH4V TGCA 1 cut(s) 139
Hsp92II CATG 1 cut(s) 151
LmnI GCTCC 1 cut(s) 33
LpnPI CCDG 2 cut(s) 48, 95
LweI GCATC 2 cut(s) 81, 148
MaeI CTAG 1 cut(s) 176
MaeIII GTNAC 1 cut(s) 115
MboII GAAGA 2 cut(s) 121, 144
MluCI AATT 1 cut(s) 183
MnlI CCTC 1 cut(s) 101
Mph1103I ATGCAT 1 cut(s) 141
MslI CAYNNNNRTG 1 cut(s) 28
NlaIII CATG 1 cut(s) 151
NsiI ATGCAT 1 cut(s) 141
RseI CAYNNNNRTG 1 cut(s) 28
SetI ASST 3 cut(s) 38, 112, 177
SfaNI GCATC 2 cut(s) 81, 148
SgeI CNNG 7 cut(s) 26, 67, 75, 94, 100, 160, 188
SmiMI CAYNNNNRTG 1 cut(s) 28
Sse9I AATT 1 cut(s) 183
SspMI CTAG 1 cut(s) 176
StyI CCWWGG 1 cut(s) 175
TaqII GACCGA 1 cut(s) 5
TasI AATT 1 cut(s) 183
TspDTI ATGAA 1 cut(s) 24
XapI RAATTY 1 cut(s) 183
XmaJI CCTAGG 1 cut(s) 175
XmiI GTMKAC 1 cut(s) 40
XspI CTAG 1 cut(s) 176
Zsp2I ATGCAT 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.