RLG00000034120

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
37037147 .. 37038166
1020 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000034120

Sequence Viewer

Length: 420 bp
ATGGATTACAGTGCTAACATGAGCTGTCTACTGAAAGTTGACACGCAATCAGGTGGATGGGAAAAGTGCCTGACCAAGATGCTGAAAAAAATCAAAGGAGCAAAATACTCTTTAAATGTCCAAGAAGGAACGCTCCGTGTTTCTGGGAAAGTAAACCCGACGAAAGTACTGAACAAGCTAAAGAAGGCTGGGAAAGTAGCAGAGATCTTGTGGGTGAATAGTGGAGTAACTGACGGTGTCTATTTTGAAGACCCAACCTCGTATAGTAATCACTATAGTCCTTATAATAATGATTACAATTATGTGAACAATGGTTATGGAGCTGGATACCATCTTTCTTCTTCATACAGCCATCATCATCAGCTTCCTATCACCCATCATTATCCCTATGGCAGCCATGGTTATGGTGGATTTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

140

Amino Acids

15.58

Weight (kDa)

9.07

Isoelectric Point (pI)

34.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 285
AccI GTMKAC 1 cut(s) 28
AfaI GTAC 1 cut(s) 168
AgsI TTSAA 1 cut(s) 248
AluBI AGCT 4 cut(s) 24, 178, 323, 364
AluI AGCT 4 cut(s) 24, 178, 323, 364
ApeKI GCWGC 1 cut(s) 393
AsuHPI GGTGA 2 cut(s) 226, 364
BbsI GAAGAC 1 cut(s) 255
BbvI GCAGC 1 cut(s) 405
BccI CCATC 4 cut(s) 51, 339, 360, 384
BciVI GTATCC 1 cut(s) 320
BfmI CTRYAG 1 cut(s) 274
BfuI GTATCC 1 cut(s) 320
BglII AGATCT 1 cut(s) 204
BisI GCNGC 1 cut(s) 394
BlsI GCNGC 1 cut(s) 395
BmcAI AGTACT 1 cut(s) 168
BmsI GCATC 1 cut(s) 69
BpiI GAAGAC 1 cut(s) 255
BsaJI CCNNGG 1 cut(s) 397
BseDI CCNNGG 1 cut(s) 397
BseGI GGATG 1 cut(s) 62
BseXI GCAGC 1 cut(s) 405
BseYI CCCAGC 1 cut(s) 188
Bsp143I GATC 1 cut(s) 204
Bsp19I CCATGG 1 cut(s) 397
BssECI CCNNGG 1 cut(s) 397
BssMI GATC 1 cut(s) 204
BssT1I CCWWGG 1 cut(s) 397
Bst4CI ACNGT 2 cut(s) 11, 236
BstDSI CCRYGG 1 cut(s) 397
BstF5I GGATG 1 cut(s) 62
BstKTI GATC 1 cut(s) 207
BstMBI GATC 1 cut(s) 204
BstSFI CTRYAG 1 cut(s) 274
BstV1I GCAGC 1 cut(s) 405
BstV2I GAAGAC 1 cut(s) 255
BstX2I RGATCY 1 cut(s) 204
BstXI CCANNNNNNTGG 1 cut(s) 404
BstYI RGATCY 1 cut(s) 204
BsuI GTATCC 1 cut(s) 320
BtgI CCRYGG 1 cut(s) 397
BtsCI GGATG 1 cut(s) 62
BtsIMutI CAGTG 1 cut(s) 16
Csp6I GTAC 1 cut(s) 167
CviAII CATG 2 cut(s) 19, 398
CviJI RGCY 7 cut(s) 24, 178, 188, 323, 351, 364, 396
CviKI_1 RGCY 7 cut(s) 24, 178, 188, 323, 351, 364, 396
CviQI GTAC 1 cut(s) 167
DpnI GATC 1 cut(s) 206
DpnII GATC 1 cut(s) 204
DraI TTTAAA 1 cut(s) 114
Eco130I CCWWGG 1 cut(s) 397
EcoT14I CCWWGG 1 cut(s) 397
ErhI CCWWGG 1 cut(s) 397
FaeI CATG 2 cut(s) 22, 401
FatI CATG 2 cut(s) 18, 397
FblI GTMKAC 1 cut(s) 28
Fnu4HI GCNGC 1 cut(s) 394
FokI GGATG 1 cut(s) 69
Fsp4HI GCNGC 1 cut(s) 394
GluI GCNGC 1 cut(s) 394
GsaI CCCAGC 1 cut(s) 192
Hin1II CATG 2 cut(s) 22, 401
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
HphI GGTGA 2 cut(s) 226, 364
Hpy166II GTNNAC 4 cut(s) 29, 40, 154, 307
Hpy8I GTNNAC 4 cut(s) 29, 40, 154, 307
Hpy99I CGWCG 1 cut(s) 163
HpyAV CCTTC 2 cut(s) 119, 178
HpyCH4III ACNGT 2 cut(s) 11, 236
Hsp92II CATG 2 cut(s) 22, 401
Kzo9I GATC 1 cut(s) 204
LmnI GCTCC 3 cut(s) 98, 138, 320
LpnPI CCDG 5 cut(s) 36, 83, 129, 174, 309
Lsp1109I GCAGC 1 cut(s) 405
LweI GCATC 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 226
MalI GATC 1 cut(s) 206
MboI GATC 1 cut(s) 204
MboII GAAGA 3 cut(s) 260, 330, 333
MflI RGATCY 1 cut(s) 204
MluCI AATT 1 cut(s) 298
MnlI CCTC 1 cut(s) 268
MseI TTAA 1 cut(s) 113
MslI CAYNNNNRTG 1 cut(s) 402
NcoI CCATGG 1 cut(s) 397
NdeII GATC 1 cut(s) 204
NlaIII CATG 2 cut(s) 22, 401
PflFI GACNNNGTC 1 cut(s) 236
PkrI GCNGC 1 cut(s) 395
PsiI TTATAA 1 cut(s) 285
PspFI CCCAGC 1 cut(s) 188
PsuI RGATCY 1 cut(s) 204
PsyI GACNNNGTC 1 cut(s) 236
RsaI GTAC 1 cut(s) 168
RsaNI GTAC 1 cut(s) 167
RseI CAYNNNNRTG 1 cut(s) 402
SaqAI TTAA 1 cut(s) 113
SatI GCNGC 1 cut(s) 394
Sau3AI GATC 1 cut(s) 204
ScaI AGTACT 1 cut(s) 168
SetI ASST 6 cut(s) 26, 55, 180, 260, 325, 366
SfaNI GCATC 1 cut(s) 69
SfcI CTRYAG 1 cut(s) 274
SmiMI CAYNNNNRTG 1 cut(s) 402
Sse9I AATT 1 cut(s) 298
StyI CCWWGG 1 cut(s) 397
TaaI ACNGT 2 cut(s) 11, 236
TasI AATT 1 cut(s) 298
TatI WGTACW 1 cut(s) 166
Tru1I TTAA 1 cut(s) 113
Tru9I TTAA 1 cut(s) 113
TscAI CASTG 1 cut(s) 16
TseI GCWGC 1 cut(s) 393
TspDTI ATGAA 1 cut(s) 333
TspGWI ACGGA 1 cut(s) 125
TspRI CASTG 1 cut(s) 16
Tth111I GACNNNGTC 1 cut(s) 236
XcmI CCANNNNNNNNNTGG 1 cut(s) 404
XmiI GTMKAC 1 cut(s) 28
ZrmI AGTACT 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.