Prupe.8G098600_v2.0.a1

Organ-specific protein S2

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
13023889 .. 13025499
1611 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G098600.1

Sequence Viewer

Length: 711 bp
ATGAAGTCCCTTTGTGCTATCTTAGCTCTTTTCTCTCTTCTTTTGTTTGTCAAAACAACATATTCAAGAAGAGATGTCGGGAAATACTGGAAAAATGTCATGAAAGAGCAACCTATGCCACAGGCAATTGAAGGCCTCCTTGTTGATATTTCTGATTCAACACCAAAAGAGAAAGCCGACTGCCATGAAAAAGTGAAAAAACCTTTTGTTGAGGTTGACGTTGAGGTTGAGGAATTTGAACCAAAGCCTAATGCTTTGGTTTACAATGCAGTTGCTGCAAAAGAAGATAAGCAGCCATTTGTGAAAGATTTTGAGCCCAGGCCAAATGCTTTGGTTTACAATGCATTTGCAGCAAAAGAAGATAAGCAGCCATTTGTGAAAGATATTGAGCCCAGGCCAAATGCTTTGGTTTACAATGCATTTGCAGCAAAAGAAGATAAGCAGCCATTTGTGAAAGACTTTGAGCCCAGGCCAAATGCTTTGGTTTACAATGCATTTGCAGCAAAAGAAGATAAGCAGCCATTTGTGAAAGATTTTGAGCCCAGGCCAAATGCTTTGGTTTACAACGCATTTGCAGCAAAAGAAGATAAGCAGCCATTTGTGAAAGACTTTGAGCCCAGGCCAAATGCAAAATTTGCAGCAAAAGAAGATCAACAGCCATTTGTGAAAGATTTTGAGCCAAGACCAAATGCTTTGGTTTACAATGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

237

Amino Acids

27.08

Weight (kDa)

5.75

Isoelectric Point (pI)

45.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 233, 632
AgsI TTSAA 4 cut(s) 66, 131, 159, 239
AjnI CCWGG 5 cut(s) 317, 392, 467, 542, 617
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
AlwNI CAGNNNCTG 1 cut(s) 275
AoxI GGCC 6 cut(s) 133, 320, 395, 470, 545, 620
ApoI RAATTY 2 cut(s) 233, 632
BanII GRGCYC 5 cut(s) 318, 393, 468, 543, 618
BciT130I CCWGG 5 cut(s) 319, 394, 469, 544, 619
Bme1390I CCNGG 5 cut(s) 319, 394, 469, 544, 619
BmrFI CCNGG 5 cut(s) 319, 394, 469, 544, 619
BsaJI CCNNGG 5 cut(s) 317, 392, 467, 542, 617
Bse1I ACTGG 1 cut(s) 92
BseBI CCWGG 5 cut(s) 319, 394, 469, 544, 619
BseDI CCNNGG 5 cut(s) 317, 392, 467, 542, 617
BseNI ACTGG 1 cut(s) 92
BshFI GGCC 6 cut(s) 135, 322, 397, 472, 547, 622
BsnI GGCC 6 cut(s) 135, 322, 397, 472, 547, 622
Bsp1286I GDGCHC 5 cut(s) 318, 393, 468, 543, 618
Bsp143I GATC 1 cut(s) 649
BspANI GGCC 6 cut(s) 135, 322, 397, 472, 547, 622
BspHI TCATGA 1 cut(s) 99
BsrI ACTGG 1 cut(s) 92
BssECI CCNNGG 5 cut(s) 317, 392, 467, 542, 617
BssMI GATC 1 cut(s) 649
Bst2UI CCWGG 5 cut(s) 319, 394, 469, 544, 619
Bst6I CTCTTC 2 cut(s) 42, 64
BstAPI GCANNNNNTGC 3 cut(s) 115, 275, 635
BstDEI CTNAG 1 cut(s) 22
BstKTI GATC 1 cut(s) 652
BstMBI GATC 1 cut(s) 649
BstMWI GCNNNNNNNGC 8 cut(s) 23, 115, 275, 350, 425, 500, 575, 635
BstNI CCWGG 5 cut(s) 319, 394, 469, 544, 619
BstSCI CCNGG 5 cut(s) 317, 392, 467, 542, 617
BsuRI GGCC 6 cut(s) 135, 322, 397, 472, 547, 622
CaiI CAGNNNCTG 1 cut(s) 275
CciI TCATGA 1 cut(s) 99
CviAII CATG 2 cut(s) 100, 185
DdeI CTNAG 1 cut(s) 22
DpnI GATC 1 cut(s) 651
DpnII GATC 1 cut(s) 649
Eam1104I CTCTTC 2 cut(s) 42, 64
EarI CTCTTC 2 cut(s) 42, 64
Eco147I AGGCCT 1 cut(s) 135
Eco24I GRGCYC 5 cut(s) 318, 393, 468, 543, 618
EcoRII CCWGG 5 cut(s) 317, 392, 467, 542, 617
EcoT22I ATGCAT 3 cut(s) 346, 421, 496
EcoT38I GRGCYC 5 cut(s) 318, 393, 468, 543, 618
FaeI CATG 2 cut(s) 103, 188
FaiI YATR 4 cut(s) 61, 101, 116, 186
FalI AAGNNNNNCTT 2 cut(s) 123, 155
FatI CATG 2 cut(s) 99, 184
FriOI GRGCYC 5 cut(s) 318, 393, 468, 543, 618
HaeIII GGCC 6 cut(s) 135, 322, 397, 472, 547, 622
Hin1II CATG 2 cut(s) 103, 188
HincII GTYRAC 1 cut(s) 217
HindII GTYRAC 1 cut(s) 217
HinfI GANTC 1 cut(s) 155
Hpy166II GTNNAC 7 cut(s) 217, 262, 337, 412, 487, 562, 700
Hpy188I TCNGA 1 cut(s) 154
Hpy188III TCNNGA 3 cut(s) 66, 79, 100
Hpy8I GTNNAC 7 cut(s) 217, 262, 337, 412, 487, 562, 700
HpyAV CCTTC 1 cut(s) 125
HpyCH4IV ACGT 1 cut(s) 219
HpyF10VI GCNNNNNNNGC 8 cut(s) 23, 115, 275, 350, 425, 500, 575, 635
HpyF3I CTNAG 1 cut(s) 22
HpySE526I ACGT 1 cut(s) 219
Hsp92II CATG 2 cut(s) 103, 188
Kzo9I GATC 1 cut(s) 649
MaeII ACGT 1 cut(s) 219
MalI GATC 1 cut(s) 651
MboI GATC 1 cut(s) 649
MboII GAAGA 8 cut(s) 29, 81, 296, 371, 446, 521, 596, 659
MfeI CAATTG 1 cut(s) 126
MhlI GDGCHC 5 cut(s) 318, 393, 468, 543, 618
MluCI AATT 3 cut(s) 126, 233, 632
MnlI CCTC 4 cut(s) 146, 205, 217, 223
Mph1103I ATGCAT 3 cut(s) 346, 421, 496
MspR9I CCNGG 5 cut(s) 319, 394, 469, 544, 619
MunI CAATTG 1 cut(s) 126
MvaI CCWGG 5 cut(s) 319, 394, 469, 544, 619
MwoI GCNNNNNNNGC 8 cut(s) 23, 115, 275, 350, 425, 500, 575, 635
NdeII GATC 1 cut(s) 649
NlaIII CATG 2 cut(s) 103, 188
NsiI ATGCAT 3 cut(s) 346, 421, 496
PagI TCATGA 1 cut(s) 99
PceI AGGCCT 1 cut(s) 135
PfeI GAWTC 1 cut(s) 155
Psp6I CCWGG 5 cut(s) 317, 392, 467, 542, 617
PspGI CCWGG 5 cut(s) 317, 392, 467, 542, 617
PstNI CAGNNNCTG 1 cut(s) 275
Sau3AI GATC 1 cut(s) 649
ScrFI CCNGG 5 cut(s) 319, 394, 469, 544, 619
SduI GDGCHC 5 cut(s) 318, 393, 468, 543, 618
SetI ASST 6 cut(s) 28, 115, 205, 216, 222, 228
Sse9I AATT 3 cut(s) 126, 233, 632
SseBI AGGCCT 1 cut(s) 135
StuI AGGCCT 1 cut(s) 135
StyD4I CCNGG 5 cut(s) 317, 392, 467, 542, 617
TaiI ACGT 1 cut(s) 222
TasI AATT 3 cut(s) 126, 233, 632
TfiI GAWTC 1 cut(s) 155
TspDTI ATGAA 3 cut(s) 17, 116, 201
XapI RAATTY 2 cut(s) 233, 632
Zsp2I ATGCAT 3 cut(s) 346, 421, 496
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.