Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr3

Orthogroup ID

OG0001115

Physical Location & Seq

Genomic Coordinates Reverse (-)

51012496 .. 51013113

Gene Structure 618 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000014304

Sequence Viewer

CDS Protein Promoter (2k)

Length: 618 bp

ATGTCTCTAAGATTTCGGTTTGATCTTACTAACTTTTCCTATGTTGTGGAGCAGTTCACTACAGCTGTAGAATCAAGAATAGGAGCAGGAGGCTACATGAAAAATTCCATTGAAAAGCAACCCACGCCAGGAGACTTACGGAAGCTCGTAAAAGAACAGTTTGAGCTTAACAATGCTGATCTATCTCATGATAAGACTGAGAAAGCCAACTGCAATGAAAATGGGAAACCTAAACCGAGACCTGACGCCACAATTTACCATGGTGACGTTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACGTTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACGTTGCCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACGTTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACAGTGAAGTAAGAGAGTCCAGAACTCTTAAAGACGAGCTACAGTCTAAGGCCATAGGTAACATGCACCCTAAGGATAAGGGTCCTAAAGATAAGCTGCAATTTGAAGTCAAAGCCAAAAGGCATGCATTTGAAGAAGATCGGCCAAATGTTTCTGTGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Organ_specific

Protein Analysis

206

Amino Acids

23.49

Weight (kDa)

5.32

Isoelectric Point (pI)

37.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001115)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g08560
prunus_persica	Prupe.8G098600_v2.0.a1 Prupe.8G098600_v2.0.a1 Prupe.8G098600_v2.0.a1 Prupe.8G098600_v2.0.a1 Prupe.8G098800_v2.0.a1 Prupe.8G098800_v2.0.a1 Prupe.8G099000_v2.0.a1 Prupe.8G099300_v2.0.a1 Prupe.8G099400_v2.0.a1 Prupe.8G099600_v2.0.a1
pyrus_communis	pycom10g06080
rosa_chinensis	RchiOBHm_Chr6g0263911 RchiOBHm_Chr6g0263961
rosa_laevigata	RLG00000014299 RLG00000014301 RLG00000014304
rosa_multiflora	Rmu_co8358715.1_g000001 Rmu_sc0002112.1_g000016 Rmu_sc0002112.1_g000024 Rmu_sc0012632.1_g000003 Rmu_sc0034069.1_g000003
rosa_roxburghii	Rroxscaffold_176G00431290 Rroxscaffold_176G00431330 Rroxscaffold_176G00431350 Rroxscaffold_7G00203700 Rroxscaffold_7G00203730 Rroxscaffold_7G00203780
rosa_rugosa	Rorug06G0006700 Rorug06G0006900 Rorug06G0007100
rosa_samantha	Rh2AG330700 Rh2BG229300 Rh2CG233200 Rh4BG141700 Rh4DG296100 Rh5AG132100 Rh5AG357800 Rh6AG126900 Rh6AG127500 Rh6AG128000 Rh6BG041500 Rh6BG112800 Rh6BG123100 Rh6BG123300 Rh6BG123400 Rh6BG123800 Rh6CG111000 Rh6CG121600 Rh6CG121800 Rh6CG122000 Rh6CG122500 Rh6DG100600 Rh6DG109000 Rh6DG109200 Rh6DG109700 Rh6DG147300
rosa_wichuraiana	Rw6G011020 Rw6G011050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	599
AcsI	RAATTY	1 cut(s)	103
AcyI	GRCGYC	1 cut(s)	246
AfiI	CCNNNNNNNGG	1 cut(s)	128
AgsI	TTSAA	7 cut(s)	113, 281, 329, 377, 425, 563, 590
AhdI	GACNNNNNGTC	4 cut(s)	293, 341, 389, 437
AjnI	CCWGG	1 cut(s)	127
AluBI	AGCT	5 cut(s)	65, 145, 166, 496, 553
AluI	AGCT	5 cut(s)	65, 145, 166, 496, 553
Alw26I	GTCTC	7 cut(s)	9, 126, 232, 280, 328, 376, 424
AoxI	GGCC	2 cut(s)	507, 599
ApeKI	GCWGC	1 cut(s)	553
ApoI	RAATTY	1 cut(s)	103
AspS9I	GGNCC	1 cut(s)	539
AsuHPI	GGTGA	5 cut(s)	275, 323, 371, 419, 467
AvaII	GGWCC	1 cut(s)	539
AxyI	CCTNAGG	1 cut(s)	528
BbvI	GCAGC	1 cut(s)	540
BciT130I	CCWGG	1 cut(s)	129
BcoDI	GTCTC	7 cut(s)	9, 126, 232, 280, 328, 376, 424
BfmI	CTRYAG	3 cut(s)	60, 66, 497
BisI	GCNGC	1 cut(s)	554
BlsI	GCNGC	1 cut(s)	555
Bme1390I	CCNGG	1 cut(s)	129
Bme18I	GGWCC	1 cut(s)	539
BmeRI	GACNNNNNGTC	4 cut(s)	293, 341, 389, 437
BmgT120I	GGNCC	1 cut(s)	539
BmiI	GGNNCC	1 cut(s)	540
BmrFI	CCNGG	1 cut(s)	129
BsaHI	GRCGYC	1 cut(s)	246
BsaI	GGTCTC	5 cut(s)	232, 280, 328, 376, 424
BsaJI	CCNNGG	5 cut(s)	259, 307, 355, 403, 451
Bsc4I	CCNNNNNNNGG	1 cut(s)	128
Bse21I	CCTNAGG	1 cut(s)	528
Bse3DI	GCAATG	1 cut(s)	220
BseBI	CCWGG	1 cut(s)	129
BseDI	CCNNGG	5 cut(s)	259, 307, 355, 403, 451
BseLI	CCNNNNNNNGG	1 cut(s)	128
BseMI	GCAATG	1 cut(s)	220
BseMII	CTCAG	1 cut(s)	189
BseXI	GCAGC	1 cut(s)	540
BshFI	GGCC	2 cut(s)	509, 601
BslI	CCNNNNNNNGG	1 cut(s)	128
BsmAI	GTCTC	7 cut(s)	9, 126, 232, 280, 328, 376, 424
BsnI	GGCC	2 cut(s)	509, 601
Bso31I	GGTCTC	5 cut(s)	232, 280, 328, 376, 424
Bsp143I	GATC	3 cut(s)	22, 178, 595
Bsp19I	CCATGG	5 cut(s)	259, 307, 355, 403, 451
BspANI	GGCC	2 cut(s)	509, 601
BspCNI	CTCAG	1 cut(s)	190
BspHI	TCATGA	1 cut(s)	187
BspLI	GGNNCC	1 cut(s)	540
BspTNI	GGTCTC	5 cut(s)	232, 280, 328, 376, 424
BsrDI	GCAATG	1 cut(s)	220
BssECI	CCNNGG	5 cut(s)	259, 307, 355, 403, 451
BssMI	GATC	3 cut(s)	22, 178, 595
BssNI	GRCGYC	1 cut(s)	246
BssT1I	CCWWGG	5 cut(s)	259, 307, 355, 403, 451
Bst2UI	CCWGG	1 cut(s)	129
Bst4CI	ACNGT	3 cut(s)	159, 461, 501
BstACI	GRCGYC	1 cut(s)	246
BstC8I	GCNNGC	1 cut(s)	582
BstDEI	CTNAG	4 cut(s)	8, 198, 504, 528
BstDSI	CCRYGG	5 cut(s)	259, 307, 355, 403, 451
BstKTI	GATC	3 cut(s)	25, 181, 598
BstMAI	GTCTC	7 cut(s)	9, 126, 232, 280, 328, 376, 424
BstMBI	GATC	3 cut(s)	22, 178, 595
BstMWI	GCNNNNNNNGC	1 cut(s)	124
BstNI	CCWGG	1 cut(s)	129
BstNSI	RCATGY	2 cut(s)	523, 584
BstSCI	CCNGG	1 cut(s)	127
BstSFI	CTRYAG	3 cut(s)	60, 66, 497
BstV1I	GCAGC	1 cut(s)	540
Bsu36I	CCTNAGG	1 cut(s)	528
BsuRI	GGCC	2 cut(s)	509, 601
BtgI	CCRYGG	5 cut(s)	259, 307, 355, 403, 451
BtsIMutI	CAGTG	1 cut(s)	466
Cac8I	GCNNGC	1 cut(s)	582
CciI	TCATGA	1 cut(s)	187
Cfr13I	GGNCC	1 cut(s)	539
CseI	GACGC	1 cut(s)	254
CviAII	CATG	9 cut(s)	97, 188, 260, 308, 356, 404, 452, 520, 581
DdeI	CTNAG	4 cut(s)	8, 198, 504, 528
DpnI	GATC	3 cut(s)	24, 180, 597
DpnII	GATC	3 cut(s)	22, 178, 595
DriI	GACNNNNNGTC	4 cut(s)	293, 341, 389, 437
EaeI	YGGCCR	1 cut(s)	599
Eam1105I	GACNNNNNGTC	4 cut(s)	293, 341, 389, 437
Eco130I	CCWWGG	5 cut(s)	259, 307, 355, 403, 451
Eco31I	GGTCTC	5 cut(s)	232, 280, 328, 376, 424
Eco47I	GGWCC	1 cut(s)	539
Eco81I	CCTNAGG	1 cut(s)	528
EcoO109I	RGGNCCY	1 cut(s)	539
EcoRII	CCWGG	1 cut(s)	127
EcoT14I	CCWWGG	5 cut(s)	259, 307, 355, 403, 451
EcoT22I	ATGCAT	1 cut(s)	586
ErhI	CCWWGG	5 cut(s)	259, 307, 355, 403, 451
FaeI	CATG	9 cut(s)	100, 191, 263, 311, 359, 407, 455, 523, 584
FatI	CATG	9 cut(s)	96, 187, 259, 307, 355, 403, 451, 519, 580
Fnu4HI	GCNGC	1 cut(s)	554
Fsp4HI	GCNGC	1 cut(s)	554
GluI	GCNGC	1 cut(s)	554
HaeIII	GGCC	2 cut(s)	509, 601
HgaI	GACGC	1 cut(s)	254
Hin1I	GRCGYC	1 cut(s)	246
Hin1II	CATG	9 cut(s)	100, 191, 263, 311, 359, 407, 455, 523, 584
HinfI	GANTC	2 cut(s)	71, 473
HphI	GGTGA	5 cut(s)	275, 323, 371, 419, 467
Hpy166II	GTNNAC	1 cut(s)	57
Hpy188III	TCNNGA	3 cut(s)	75, 188, 477
Hpy8I	GTNNAC	1 cut(s)	57
HpyCH4III	ACNGT	3 cut(s)	159, 461, 501
HpyCH4IV	ACGT	4 cut(s)	267, 315, 363, 411
HpyCH4V	TGCA	4 cut(s)	213, 523, 556, 584
HpyF10VI	GCNNNNNNNGC	1 cut(s)	124
HpyF3I	CTNAG	4 cut(s)	8, 198, 504, 528
HpySE526I	ACGT	4 cut(s)	267, 315, 363, 411
Hsp92I	GRCGYC	1 cut(s)	246
Hsp92II	CATG	9 cut(s)	100, 191, 263, 311, 359, 407, 455, 523, 584
Kzo9I	GATC	3 cut(s)	22, 178, 595
LmnI	GCTCC	2 cut(s)	49, 83
LpnPI	CCDG	9 cut(s)	72, 114, 141, 255, 303, 351, 399, 447, 490
Lsp1109I	GCAGC	1 cut(s)	540
MaeII	ACGT	4 cut(s)	267, 315, 363, 411
MalI	GATC	3 cut(s)	24, 180, 597
MboI	GATC	3 cut(s)	22, 178, 595
MboII	GAAGA	2 cut(s)	602, 605
MluCI	AATT	7 cut(s)	103, 252, 300, 348, 396, 444, 557
MlyI	GAGTC	1 cut(s)	482
MnlI	CCTC	1 cut(s)	83
Mph1103I	ATGCAT	1 cut(s)	586
MseI	TTAA	2 cut(s)	168, 486
MspA1I	CMGCKG	1 cut(s)	65
MspR9I	CCNGG	1 cut(s)	129
MvaI	CCWGG	1 cut(s)	129
MwoI	GCNNNNNNNGC	1 cut(s)	124
NcoI	CCATGG	5 cut(s)	259, 307, 355, 403, 451
NdeII	GATC	3 cut(s)	22, 178, 595
NlaIII	CATG	9 cut(s)	100, 191, 263, 311, 359, 407, 455, 523, 584
NlaIV	GGNNCC	1 cut(s)	540
NmeAIII	GCCGAG	1 cut(s)	394
NmuCI	GTSAC	9 cut(s)	263, 295, 311, 343, 359, 391, 407, 439, 455
NsiI	ATGCAT	1 cut(s)	586
NspI	RCATGY	2 cut(s)	523, 584
PaeI	GCATGC	1 cut(s)	584
PagI	TCATGA	1 cut(s)	187
PfeI	GAWTC	1 cut(s)	71
PflFI	GACNNNGTC	3 cut(s)	269, 317, 413
PkrI	GCNGC	1 cut(s)	555
PleI	GAGTC	1 cut(s)	481
PpsI	GAGTC	1 cut(s)	481
PpuMI	RGGWCCY	1 cut(s)	539
Psp5II	RGGWCCY	1 cut(s)	539
Psp6I	CCWGG	1 cut(s)	127
PspGI	CCWGG	1 cut(s)	127
PspN4I	GGNNCC	1 cut(s)	540
PspPI	GGNCC	1 cut(s)	539
PspPPI	RGGWCCY	1 cut(s)	539
PsyI	GACNNNGTC	3 cut(s)	269, 317, 413
PvuII	CAGCTG	1 cut(s)	65
SaqAI	TTAA	2 cut(s)	168, 486
SatI	GCNGC	1 cut(s)	554
Sau3AI	GATC	3 cut(s)	22, 178, 595
Sau96I	GGNCC	1 cut(s)	539
SchI	GAGTC	1 cut(s)	482
ScrFI	CCNGG	1 cut(s)	129
SfcI	CTRYAG	3 cut(s)	60, 66, 497
SinI	GGWCC	1 cut(s)	539
SphI	GCATGC	1 cut(s)	584
Sse9I	AATT	7 cut(s)	103, 252, 300, 348, 396, 444, 557
StyD4I	CCNGG	1 cut(s)	127
StyI	CCWWGG	5 cut(s)	259, 307, 355, 403, 451
TaaI	ACNGT	3 cut(s)	159, 461, 501
TaiI	ACGT	4 cut(s)	270, 318, 366, 414
TaqI	TCGA	3 cut(s)	273, 321, 417
TasI	AATT	7 cut(s)	103, 252, 300, 348, 396, 444, 557
TfiI	GAWTC	1 cut(s)	71
Tru1I	TTAA	2 cut(s)	168, 486
Tru9I	TTAA	2 cut(s)	168, 486
TscAI	CASTG	1 cut(s)	466
TseFI	GTSAC	9 cut(s)	263, 295, 311, 343, 359, 391, 407, 439, 455
TseI	GCWGC	1 cut(s)	553
Tsp45I	GTSAC	9 cut(s)	263, 295, 311, 343, 359, 391, 407, 439, 455
TspDTI	ATGAA	2 cut(s)	113, 231
TspGWI	ACGGA	1 cut(s)	154
TspRI	CASTG	1 cut(s)	466
Tth111I	GACNNNGTC	3 cut(s)	269, 317, 413
VpaK11BI	GGWCC	1 cut(s)	539
XapI	RAATTY	1 cut(s)	103
XceI	RCATGY	2 cut(s)	523, 584
Zsp2I	ATGCAT	1 cut(s)	586

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.