RchiOBHm_Chr6g0263911

Organ-specific protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
18897616 .. 18898631
1016 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23670

Sequence Viewer

Length: 708 bp
ATGATTCTCGTGGCTAGCTTAACTTTATTATATGAAGGCTTTTATTCTCCTACTAGTTTATCTATAAATATTCTGAATTTACGTATCATTGCAACATCGAAGGAAGGCTTCTTTCATAGCATTGCCATTATGAACTCCCTTTGTGCCATCTTAGCTCTGCTCTCACTTCTTTTGTTCACTACAACTGTAGAATCGAGAATAGGTGCAGGAGGCTACATGAAAAATTCCATTAAAAAGCAACCCACGCCAGGAGACTTACGGAAGCTCGTAAAAGAACAGTTTGAGCTTCACAATGCTGATCTATCTGAAGATAAGACTGAGAAAGCCAACTGCAATGAAAATGGGAAACCTAACACTGAATTTGAGATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACAGTGAAGTAACAGAGTCCAGAACTCTTAAAGACGAGCTAGAGTCTAAGGCCATAGGTAACATGCACCCTAAGGATAATGGTCCTAAAGATAAGCTGCCATTTGAAGTCAAAGCCAAAAGGCATGCATTTGAAGTAGGTCGGCCAAATGTTTCTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

235

Amino Acids

26.43

Weight (kDa)

5.22

Isoelectric Point (pI)

36.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Organ_specific PF10950 69 - 165 5.7e-08 Organ specific protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 689
AcsI RAATTY 3 cut(s) 76, 223, 359
AcuI CTGAAG 1 cut(s) 327
AfiI CCNNNNNNNGG 1 cut(s) 248
AgsI TTSAA 6 cut(s) 380, 428, 467, 515, 653, 680
AhdI GACNNNNNGTC 4 cut(s) 392, 440, 479, 527
AhlI ACTAGT 1 cut(s) 53
AjnI CCWGG 1 cut(s) 247
AluBI AGCT 6 cut(s) 18, 155, 265, 286, 586, 643
AluI AGCT 6 cut(s) 18, 155, 265, 286, 586, 643
Alw26I GTCTC 5 cut(s) 246, 379, 427, 466, 514
AoxI GGCC 2 cut(s) 597, 689
ApeKI GCWGC 1 cut(s) 643
ApoI RAATTY 3 cut(s) 76, 223, 359
AspS9I GGNCC 1 cut(s) 629
AsuHPI GGTGA 4 cut(s) 422, 470, 509, 557
AsuNHI GCTAGC 1 cut(s) 14
AvaII GGWCC 1 cut(s) 629
AxyI CCTNAGG 1 cut(s) 618
BauI CACGAG 1 cut(s) 8
BbvI GCAGC 1 cut(s) 630
BccI CCATC 1 cut(s) 155
BciT130I CCWGG 1 cut(s) 249
BcoDI GTCTC 5 cut(s) 246, 379, 427, 466, 514
BcuI ACTAGT 1 cut(s) 53
BfaI CTAG 3 cut(s) 15, 54, 587
BfmI CTRYAG 1 cut(s) 186
BisI GCNGC 1 cut(s) 644
BlsI GCNGC 1 cut(s) 645
Bme1390I CCNGG 1 cut(s) 249
Bme18I GGWCC 1 cut(s) 629
BmeRI GACNNNNNGTC 4 cut(s) 392, 440, 479, 527
BmgT120I GGNCC 1 cut(s) 629
BmrFI CCNGG 1 cut(s) 249
BmtI GCTAGC 1 cut(s) 18
BsaAI YACGTR 1 cut(s) 83
BsaI GGTCTC 4 cut(s) 379, 427, 466, 514
BsaJI CCNNGG 4 cut(s) 406, 454, 493, 541
Bsc4I CCNNNNNNNGG 1 cut(s) 248
Bse21I CCTNAGG 1 cut(s) 618
Bse3DI GCAATG 3 cut(s) 87, 120, 340
BseBI CCWGG 1 cut(s) 249
BseDI CCNNGG 4 cut(s) 406, 454, 493, 541
BseLI CCNNNNNNNGG 1 cut(s) 248
BseMI GCAATG 3 cut(s) 87, 120, 340
BseMII CTCAG 1 cut(s) 309
BseXI GCAGC 1 cut(s) 630
BsgI GTGCAG 1 cut(s) 225
BshFI GGCC 2 cut(s) 599, 691
BslI CCNNNNNNNGG 1 cut(s) 248
BsmAI GTCTC 5 cut(s) 246, 379, 427, 466, 514
BsnI GGCC 2 cut(s) 599, 691
Bso31I GGTCTC 4 cut(s) 379, 427, 466, 514
Bsp143I GATC 1 cut(s) 298
Bsp19I CCATGG 4 cut(s) 406, 454, 493, 541
BspANI GGCC 2 cut(s) 599, 691
BspCNI CTCAG 1 cut(s) 310
BspOI GCTAGC 1 cut(s) 18
BspTNI GGTCTC 4 cut(s) 379, 427, 466, 514
BsrDI GCAATG 3 cut(s) 87, 120, 340
BssECI CCNNGG 4 cut(s) 406, 454, 493, 541
BssMI GATC 1 cut(s) 298
BssSI CACGAG 1 cut(s) 8
BssT1I CCWWGG 4 cut(s) 406, 454, 493, 541
Bst2BI CACGAG 1 cut(s) 8
Bst2UI CCWGG 1 cut(s) 249
Bst4CI ACNGT 3 cut(s) 187, 279, 551
BstBAI YACGTR 1 cut(s) 83
BstC8I GCNNGC 2 cut(s) 16, 672
BstDEI CTNAG 4 cut(s) 151, 318, 594, 618
BstDSI CCRYGG 4 cut(s) 406, 454, 493, 541
BstKTI GATC 1 cut(s) 301
BstMAI GTCTC 5 cut(s) 246, 379, 427, 466, 514
BstMBI GATC 1 cut(s) 298
BstMWI GCNNNNNNNGC 2 cut(s) 152, 244
BstNI CCWGG 1 cut(s) 249
BstNSI RCATGY 2 cut(s) 613, 674
BstSCI CCNGG 1 cut(s) 247
BstSFI CTRYAG 1 cut(s) 186
BstSNI TACGTA 1 cut(s) 83
BstV1I GCAGC 1 cut(s) 630
Bsu36I CCTNAGG 1 cut(s) 618
BsuRI GGCC 2 cut(s) 599, 691
BtgI CCRYGG 4 cut(s) 406, 454, 493, 541
BtsIMutI CAGTG 2 cut(s) 354, 556
Cac8I GCNNGC 2 cut(s) 16, 672
Cfr13I GGNCC 1 cut(s) 629
CviAII CATG 7 cut(s) 217, 407, 455, 494, 542, 610, 671
DdeI CTNAG 4 cut(s) 151, 318, 594, 618
DpnI GATC 1 cut(s) 300
DpnII GATC 1 cut(s) 298
DriI GACNNNNNGTC 4 cut(s) 392, 440, 479, 527
EaeI YGGCCR 1 cut(s) 689
Eam1105I GACNNNNNGTC 4 cut(s) 392, 440, 479, 527
Eco105I TACGTA 1 cut(s) 83
Eco130I CCWWGG 4 cut(s) 406, 454, 493, 541
Eco31I GGTCTC 4 cut(s) 379, 427, 466, 514
Eco47I GGWCC 1 cut(s) 629
Eco57I CTGAAG 1 cut(s) 327
Eco81I CCTNAGG 1 cut(s) 618
EcoRII CCWGG 1 cut(s) 247
EcoT14I CCWWGG 4 cut(s) 406, 454, 493, 541
EcoT22I ATGCAT 1 cut(s) 676
ErhI CCWWGG 4 cut(s) 406, 454, 493, 541
FaeI CATG 7 cut(s) 220, 410, 458, 497, 545, 613, 674
FalI AAGNNNNNCTT 2 cut(s) 92, 124
FatI CATG 7 cut(s) 216, 406, 454, 493, 541, 609, 670
Fnu4HI GCNGC 1 cut(s) 644
Fsp4HI GCNGC 1 cut(s) 644
FspBI CTAG 3 cut(s) 15, 54, 587
GluI GCNGC 1 cut(s) 644
HaeIII GGCC 2 cut(s) 599, 691
Hin1II CATG 7 cut(s) 220, 410, 458, 497, 545, 613, 674
HinfI GANTC 4 cut(s) 4, 191, 563, 590
HphI GGTGA 4 cut(s) 422, 470, 509, 557
Hpy166II GTNNAC 1 cut(s) 177
Hpy188I TCNGA 2 cut(s) 75, 307
Hpy188III TCNNGA 2 cut(s) 195, 567
Hpy8I GTNNAC 1 cut(s) 177
HpyAV CCTTC 3 cut(s) 29, 94, 98
HpyCH4III ACNGT 3 cut(s) 187, 279, 551
HpyCH4IV ACGT 1 cut(s) 82
HpyCH4V TGCA 5 cut(s) 92, 206, 333, 613, 674
HpyF10VI GCNNNNNNNGC 2 cut(s) 152, 244
HpyF3I CTNAG 4 cut(s) 151, 318, 594, 618
HpySE526I ACGT 1 cut(s) 82
Hsp92II CATG 7 cut(s) 220, 410, 458, 497, 545, 613, 674
Kzo9I GATC 1 cut(s) 298
LpnPI CCDG 8 cut(s) 192, 234, 261, 402, 450, 489, 537, 580
Lsp1109I GCAGC 1 cut(s) 630
MaeI CTAG 3 cut(s) 15, 54, 587
MaeII ACGT 1 cut(s) 82
MalI GATC 1 cut(s) 300
MboI GATC 1 cut(s) 298
MboII GAAGA 1 cut(s) 320
MluCI AATT 7 cut(s) 76, 223, 359, 399, 447, 486, 534
MlyI GAGTC 2 cut(s) 572, 599
MnlI CCTC 1 cut(s) 203
Mph1103I ATGCAT 1 cut(s) 676
MseI TTAA 3 cut(s) 20, 231, 576
MspR9I CCNGG 1 cut(s) 249
MvaI CCWGG 1 cut(s) 249
MwoI GCNNNNNNNGC 2 cut(s) 152, 244
NcoI CCATGG 4 cut(s) 406, 454, 493, 541
NdeII GATC 1 cut(s) 298
NheI GCTAGC 1 cut(s) 14
NlaIII CATG 7 cut(s) 220, 410, 458, 497, 545, 613, 674
NmuCI GTSAC 8 cut(s) 394, 410, 442, 458, 481, 497, 529, 545
NsiI ATGCAT 1 cut(s) 676
NspI RCATGY 2 cut(s) 613, 674
PaeI GCATGC 1 cut(s) 674
PfeI GAWTC 2 cut(s) 4, 191
PflFI GACNNNGTC 2 cut(s) 416, 503
PkrI GCNGC 1 cut(s) 645
PleI GAGTC 2 cut(s) 571, 598
PpsI GAGTC 2 cut(s) 571, 598
Ppu21I YACGTR 1 cut(s) 83
Psp6I CCWGG 1 cut(s) 247
PspGI CCWGG 1 cut(s) 247
PspPI GGNCC 1 cut(s) 629
PsyI GACNNNGTC 2 cut(s) 416, 503
SaqAI TTAA 3 cut(s) 20, 231, 576
SatI GCNGC 1 cut(s) 644
Sau3AI GATC 1 cut(s) 298
Sau96I GGNCC 1 cut(s) 629
SchI GAGTC 2 cut(s) 572, 599
ScrFI CCNGG 1 cut(s) 249
SfcI CTRYAG 1 cut(s) 186
SinI GGWCC 1 cut(s) 629
SnaBI TACGTA 1 cut(s) 83
SpeI ACTAGT 1 cut(s) 53
SphI GCATGC 1 cut(s) 674
Sse9I AATT 7 cut(s) 76, 223, 359, 399, 447, 486, 534
SspI AATATT 1 cut(s) 70
SspMI CTAG 3 cut(s) 15, 54, 587
StyD4I CCNGG 1 cut(s) 247
StyI CCWWGG 4 cut(s) 406, 454, 493, 541
TaaI ACNGT 3 cut(s) 187, 279, 551
TaiI ACGT 1 cut(s) 85
TaqI TCGA 5 cut(s) 98, 194, 372, 420, 507
TasI AATT 7 cut(s) 76, 223, 359, 399, 447, 486, 534
TfiI GAWTC 2 cut(s) 4, 191
Tru1I TTAA 3 cut(s) 20, 231, 576
Tru9I TTAA 3 cut(s) 20, 231, 576
TscAI CASTG 2 cut(s) 361, 556
TseFI GTSAC 8 cut(s) 394, 410, 442, 458, 481, 497, 529, 545
TseI GCWGC 1 cut(s) 643
Tsp45I GTSAC 8 cut(s) 394, 410, 442, 458, 481, 497, 529, 545
TspDTI ATGAA 5 cut(s) 48, 104, 146, 233, 351
TspGWI ACGGA 1 cut(s) 274
TspRI CASTG 2 cut(s) 361, 556
Tth111I GACNNNGTC 2 cut(s) 416, 503
VpaK11BI GGWCC 1 cut(s) 629
XapI RAATTY 3 cut(s) 76, 223, 359
XceI RCATGY 2 cut(s) 613, 674
XspI CTAG 3 cut(s) 15, 54, 587
Zsp2I ATGCAT 1 cut(s) 676
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.