Rw6G011020

Organ-specific protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
OG0001115
Physical Location & Seq
Forward (+)
19442546 .. 19443590
1045 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G011020.1

Sequence Viewer

Length: 531 bp
ATGAACTCCCTTTGTGCCATCTTAGCTCTTCTCTCACTTCTTTTGTTCACTACAACGGTAGAATCAAGAATAGGTGCAGGAGGCTACATGAAAAATTCCATTAAAAAGCAACCCACGCCAGGAGACTTACGGAAGCTCGTAAAAGAACAGTTTGAGCTTCACAATGCTGATCTATCTGATGATAAGACTGAGAAAGCGAATTGCAATGAAAATGGGAAACCTAACACTGAATTTGAGATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGCGACTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACAGTGAAGTAACAGAGTCCAGAACTCTTAAAGACGAGCTAGAGTCTAAGGCCATAGGTAACATTCACCCTAAGGATAATGGTCCTAAAGATAAGCTGCCATTTGAAGTCAAAGCCAAAAGGCATGCATTTGAAGTAGATCGGCCAAATGTTTCTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Organ_specific

Protein Analysis

176

Amino Acids

19.85

Weight (kDa)

5.18

Isoelectric Point (pI)

32.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Organ_specific PF10950 26 - 107 6.2e-06 Organ specific protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 512
AcsI RAATTY 2 cut(s) 94, 230
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 5 cut(s) 251, 290, 338, 476, 503
AhdI GACNNNNNGTC 3 cut(s) 263, 302, 350
AjnI CCWGG 1 cut(s) 118
AluBI AGCT 5 cut(s) 26, 136, 157, 409, 466
AluI AGCT 5 cut(s) 26, 136, 157, 409, 466
Alw26I GTCTC 4 cut(s) 117, 250, 289, 337
AoxI GGCC 2 cut(s) 420, 512
ApeKI GCWGC 1 cut(s) 466
ApoI RAATTY 2 cut(s) 94, 230
AspS9I GGNCC 1 cut(s) 452
AsuHPI GGTGA 3 cut(s) 332, 380, 428
AvaII GGWCC 1 cut(s) 452
AxyI CCTNAGG 1 cut(s) 441
BbvI GCAGC 1 cut(s) 453
BccI CCATC 1 cut(s) 26
BciT130I CCWGG 1 cut(s) 120
BcoDI GTCTC 4 cut(s) 117, 250, 289, 337
BfaI CTAG 1 cut(s) 410
BisI GCNGC 1 cut(s) 467
BlsI GCNGC 1 cut(s) 468
Bme1390I CCNGG 1 cut(s) 120
Bme18I GGWCC 1 cut(s) 452
BmeRI GACNNNNNGTC 3 cut(s) 263, 302, 350
BmgT120I GGNCC 1 cut(s) 452
BmrFI CCNGG 1 cut(s) 120
BsaI GGTCTC 3 cut(s) 250, 289, 337
BsaJI CCNNGG 3 cut(s) 277, 316, 364
Bsc4I CCNNNNNNNGG 1 cut(s) 119
Bse21I CCTNAGG 1 cut(s) 441
Bse3DI GCAATG 1 cut(s) 211
BseBI CCWGG 1 cut(s) 120
BseDI CCNNGG 3 cut(s) 277, 316, 364
BseLI CCNNNNNNNGG 1 cut(s) 119
BseMI GCAATG 1 cut(s) 211
BseMII CTCAG 1 cut(s) 180
BseXI GCAGC 1 cut(s) 453
BsgI GTGCAG 1 cut(s) 96
BshFI GGCC 2 cut(s) 422, 514
BslI CCNNNNNNNGG 1 cut(s) 119
BsmAI GTCTC 4 cut(s) 117, 250, 289, 337
BsnI GGCC 2 cut(s) 422, 514
Bso31I GGTCTC 3 cut(s) 250, 289, 337
Bsp143I GATC 2 cut(s) 169, 508
Bsp19I CCATGG 3 cut(s) 277, 316, 364
BspANI GGCC 2 cut(s) 422, 514
BspCNI CTCAG 1 cut(s) 181
BspQI GCTCTTC 1 cut(s) 33
BspTNI GGTCTC 3 cut(s) 250, 289, 337
BsrDI GCAATG 1 cut(s) 211
BssECI CCNNGG 3 cut(s) 277, 316, 364
BssMI GATC 2 cut(s) 169, 508
BssT1I CCWWGG 3 cut(s) 277, 316, 364
Bst2UI CCWGG 1 cut(s) 120
Bst4CI ACNGT 3 cut(s) 58, 150, 374
Bst6I CTCTTC 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 495
BstDEI CTNAG 4 cut(s) 22, 189, 417, 441
BstDSI CCRYGG 3 cut(s) 277, 316, 364
BstKTI GATC 2 cut(s) 172, 511
BstMAI GTCTC 4 cut(s) 117, 250, 289, 337
BstMBI GATC 2 cut(s) 169, 508
BstMWI GCNNNNNNNGC 2 cut(s) 23, 115
BstNI CCWGG 1 cut(s) 120
BstNSI RCATGY 1 cut(s) 497
BstSCI CCNGG 1 cut(s) 118
BstV1I GCAGC 1 cut(s) 453
Bsu36I CCTNAGG 1 cut(s) 441
BsuRI GGCC 2 cut(s) 422, 514
BtgI CCRYGG 3 cut(s) 277, 316, 364
BtsIMutI CAGTG 2 cut(s) 225, 379
Cac8I GCNNGC 1 cut(s) 495
Cfr13I GGNCC 1 cut(s) 452
CviAII CATG 5 cut(s) 88, 278, 317, 365, 494
CviJI RGCY 9 cut(s) 26, 84, 136, 157, 409, 422, 466, 485, 514
CviKI_1 RGCY 9 cut(s) 26, 84, 136, 157, 409, 422, 466, 485, 514
DdeI CTNAG 4 cut(s) 22, 189, 417, 441
DpnI GATC 2 cut(s) 171, 510
DpnII GATC 2 cut(s) 169, 508
DriI GACNNNNNGTC 3 cut(s) 263, 302, 350
EaeI YGGCCR 1 cut(s) 512
Eam1104I CTCTTC 1 cut(s) 33
Eam1105I GACNNNNNGTC 3 cut(s) 263, 302, 350
EarI CTCTTC 1 cut(s) 33
Eco130I CCWWGG 3 cut(s) 277, 316, 364
Eco31I GGTCTC 3 cut(s) 250, 289, 337
Eco47I GGWCC 1 cut(s) 452
Eco81I CCTNAGG 1 cut(s) 441
EcoRII CCWGG 1 cut(s) 118
EcoT14I CCWWGG 3 cut(s) 277, 316, 364
EcoT22I ATGCAT 1 cut(s) 499
ErhI CCWWGG 3 cut(s) 277, 316, 364
FaeI CATG 5 cut(s) 91, 281, 320, 368, 497
FaiI YATR 6 cut(s) 89, 279, 318, 366, 425, 495
FatI CATG 5 cut(s) 87, 277, 316, 364, 493
Fnu4HI GCNGC 1 cut(s) 467
Fsp4HI GCNGC 1 cut(s) 467
FspBI CTAG 1 cut(s) 410
GluI GCNGC 1 cut(s) 467
HaeIII GGCC 2 cut(s) 422, 514
Hin1II CATG 5 cut(s) 91, 281, 320, 368, 497
HinfI GANTC 3 cut(s) 62, 386, 413
HphI GGTGA 3 cut(s) 332, 380, 428
Hpy166II GTNNAC 1 cut(s) 48
Hpy188I TCNGA 1 cut(s) 178
Hpy188III TCNNGA 2 cut(s) 66, 390
Hpy8I GTNNAC 1 cut(s) 48
HpyCH4III ACNGT 3 cut(s) 58, 150, 374
HpyCH4V TGCA 3 cut(s) 77, 204, 497
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 115
HpyF3I CTNAG 4 cut(s) 22, 189, 417, 441
Hsp92II CATG 5 cut(s) 91, 281, 320, 368, 497
Kzo9I GATC 2 cut(s) 169, 508
LguI GCTCTTC 1 cut(s) 33
LpnPI CCDG 7 cut(s) 63, 105, 132, 273, 312, 360, 403
Lsp1109I GCAGC 1 cut(s) 453
MaeI CTAG 1 cut(s) 410
MaeIII GTNAC 7 cut(s) 265, 304, 320, 352, 368, 379, 428
MalI GATC 2 cut(s) 171, 510
MboI GATC 2 cut(s) 169, 508
MboII GAAGA 1 cut(s) 20
MluCI AATT 6 cut(s) 94, 199, 230, 270, 309, 357
MlyI GAGTC 2 cut(s) 395, 422
MnlI CCTC 1 cut(s) 74
Mph1103I ATGCAT 1 cut(s) 499
MseI TTAA 2 cut(s) 102, 399
MspR9I CCNGG 1 cut(s) 120
MvaI CCWGG 1 cut(s) 120
MwoI GCNNNNNNNGC 2 cut(s) 23, 115
NcoI CCATGG 3 cut(s) 277, 316, 364
NdeII GATC 2 cut(s) 169, 508
NlaIII CATG 5 cut(s) 91, 281, 320, 368, 497
NmuCI GTSAC 5 cut(s) 265, 304, 320, 352, 368
NsiI ATGCAT 1 cut(s) 499
NspI RCATGY 1 cut(s) 497
PaeI GCATGC 1 cut(s) 497
PciSI GCTCTTC 1 cut(s) 33
PfeI GAWTC 1 cut(s) 62
PflFI GACNNNGTC 1 cut(s) 326
PkrI GCNGC 1 cut(s) 468
PleI GAGTC 2 cut(s) 394, 421
PpsI GAGTC 2 cut(s) 394, 421
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
PspPI GGNCC 1 cut(s) 452
PsyI GACNNNGTC 1 cut(s) 326
SapI GCTCTTC 1 cut(s) 33
SaqAI TTAA 2 cut(s) 102, 399
SatI GCNGC 1 cut(s) 467
Sau3AI GATC 2 cut(s) 169, 508
Sau96I GGNCC 1 cut(s) 452
SchI GAGTC 2 cut(s) 395, 422
ScrFI CCNGG 1 cut(s) 120
SinI GGWCC 1 cut(s) 452
SphI GCATGC 1 cut(s) 497
Sse9I AATT 6 cut(s) 94, 199, 230, 270, 309, 357
SspMI CTAG 1 cut(s) 410
StyD4I CCNGG 1 cut(s) 118
StyI CCWWGG 3 cut(s) 277, 316, 364
TaaI ACNGT 3 cut(s) 58, 150, 374
TaqI TCGA 2 cut(s) 243, 330
TasI AATT 6 cut(s) 94, 199, 230, 270, 309, 357
TfiI GAWTC 1 cut(s) 62
Tru1I TTAA 2 cut(s) 102, 399
Tru9I TTAA 2 cut(s) 102, 399
TscAI CASTG 2 cut(s) 232, 379
TseFI GTSAC 5 cut(s) 265, 304, 320, 352, 368
TseI GCWGC 1 cut(s) 466
Tsp45I GTSAC 5 cut(s) 265, 304, 320, 352, 368
TspDTI ATGAA 3 cut(s) 17, 104, 222
TspGWI ACGGA 1 cut(s) 145
TspRI CASTG 2 cut(s) 232, 379
Tth111I GACNNNGTC 1 cut(s) 326
VpaK11BI GGWCC 1 cut(s) 452
XapI RAATTY 2 cut(s) 94, 230
XceI RCATGY 1 cut(s) 497
XspI CTAG 1 cut(s) 410
Zsp2I ATGCAT 1 cut(s) 499
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.