Rh6AG126900

Organ-specific protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0001115
Physical Location & Seq
Forward (+)
19169921 .. 19172403
2483 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG126900.1

Sequence Viewer

Length: 579 bp
ATGAACTCCCTTTGTGCCATCTTAGCTCTTCTCTCACTTCTTTTGTTCACTACAACGGTAGAATCAAGAATAGGTGCAGGAGGCTACATGAAAAATTCCATTAAAAAGCAACCCACGCCAGGAGACTTACGGAAGCTTGTAAAAGAACAGTTTGAGCTTCACAATGCTGATCTATCTGATGATAAGACTGAGAAAGCGAACTGCAATGAAAATGGGAAACCTAACACTGAATTTGAGATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGCGACTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATAGTGACAGTGAAGTAACAGAGTCCAGAACTCTTAAAGACGAGCTAGAGTCTAAGGCCATAGGTAACATGCACCCTAAGGATAATGGTCCTAAAGATAAGCTGCCATTTGAAGTCAAAGCCAAAAGGCATGCATTTGAAGTAGATCGGCCAAATGTTTCTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Organ_specific

Protein Analysis

192

Amino Acids

21.76

Weight (kDa)

5.03

Isoelectric Point (pI)

31.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Organ_specific PF10950 26 - 122 8e-08 Organ specific protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 560
AcsI RAATTY 2 cut(s) 94, 230
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 6 cut(s) 251, 290, 338, 386, 524, 551
AhdI GACNNNNNGTC 4 cut(s) 263, 302, 350, 398
AjnI CCWGG 1 cut(s) 118
AluBI AGCT 5 cut(s) 26, 136, 157, 457, 514
AluI AGCT 5 cut(s) 26, 136, 157, 457, 514
Alw26I GTCTC 5 cut(s) 117, 250, 289, 337, 385
AoxI GGCC 2 cut(s) 468, 560
ApeKI GCWGC 1 cut(s) 514
ApoI RAATTY 2 cut(s) 94, 230
AspS9I GGNCC 1 cut(s) 500
AsuHPI GGTGA 2 cut(s) 332, 380
AvaII GGWCC 1 cut(s) 500
AxyI CCTNAGG 1 cut(s) 489
BbvI GCAGC 1 cut(s) 501
BccI CCATC 1 cut(s) 26
BciT130I CCWGG 1 cut(s) 120
BcoDI GTCTC 5 cut(s) 117, 250, 289, 337, 385
BfaI CTAG 1 cut(s) 458
BisI GCNGC 1 cut(s) 515
BlsI GCNGC 1 cut(s) 516
Bme1390I CCNGG 1 cut(s) 120
Bme18I GGWCC 1 cut(s) 500
BmeRI GACNNNNNGTC 4 cut(s) 263, 302, 350, 398
BmgT120I GGNCC 1 cut(s) 500
BmrFI CCNGG 1 cut(s) 120
BsaI GGTCTC 4 cut(s) 250, 289, 337, 385
BsaJI CCNNGG 3 cut(s) 277, 316, 364
Bsc4I CCNNNNNNNGG 1 cut(s) 119
Bse21I CCTNAGG 1 cut(s) 489
Bse3DI GCAATG 1 cut(s) 211
BseBI CCWGG 1 cut(s) 120
BseDI CCNNGG 3 cut(s) 277, 316, 364
BseLI CCNNNNNNNGG 1 cut(s) 119
BseMI GCAATG 1 cut(s) 211
BseMII CTCAG 1 cut(s) 180
BseXI GCAGC 1 cut(s) 501
BsgI GTGCAG 1 cut(s) 96
BshFI GGCC 2 cut(s) 470, 562
BslI CCNNNNNNNGG 1 cut(s) 119
BsmAI GTCTC 5 cut(s) 117, 250, 289, 337, 385
BsnI GGCC 2 cut(s) 470, 562
Bso31I GGTCTC 4 cut(s) 250, 289, 337, 385
Bsp143I GATC 2 cut(s) 169, 556
Bsp19I CCATGG 3 cut(s) 277, 316, 364
BspANI GGCC 2 cut(s) 470, 562
BspCNI CTCAG 1 cut(s) 181
BspQI GCTCTTC 1 cut(s) 33
BspTNI GGTCTC 4 cut(s) 250, 289, 337, 385
BsrDI GCAATG 1 cut(s) 211
BssECI CCNNGG 3 cut(s) 277, 316, 364
BssMI GATC 2 cut(s) 169, 556
BssT1I CCWWGG 3 cut(s) 277, 316, 364
Bst2UI CCWGG 1 cut(s) 120
Bst4CI ACNGT 3 cut(s) 58, 150, 422
Bst6I CTCTTC 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 543
BstDEI CTNAG 4 cut(s) 22, 189, 465, 489
BstDSI CCRYGG 3 cut(s) 277, 316, 364
BstKTI GATC 2 cut(s) 172, 559
BstMAI GTCTC 5 cut(s) 117, 250, 289, 337, 385
BstMBI GATC 2 cut(s) 169, 556
BstMWI GCNNNNNNNGC 2 cut(s) 23, 115
BstNI CCWGG 1 cut(s) 120
BstNSI RCATGY 2 cut(s) 484, 545
BstSCI CCNGG 1 cut(s) 118
BstV1I GCAGC 1 cut(s) 501
Bsu36I CCTNAGG 1 cut(s) 489
BsuRI GGCC 2 cut(s) 470, 562
BtgI CCRYGG 3 cut(s) 277, 316, 364
BtsIMutI CAGTG 2 cut(s) 225, 427
Cac8I GCNNGC 1 cut(s) 543
Cfr13I GGNCC 1 cut(s) 500
CviAII CATG 6 cut(s) 88, 278, 317, 365, 481, 542
CviJI RGCY 9 cut(s) 26, 84, 136, 157, 457, 470, 514, 533, 562
CviKI_1 RGCY 9 cut(s) 26, 84, 136, 157, 457, 470, 514, 533, 562
DdeI CTNAG 4 cut(s) 22, 189, 465, 489
DpnI GATC 2 cut(s) 171, 558
DpnII GATC 2 cut(s) 169, 556
DriI GACNNNNNGTC 4 cut(s) 263, 302, 350, 398
EaeI YGGCCR 1 cut(s) 560
Eam1104I CTCTTC 1 cut(s) 33
Eam1105I GACNNNNNGTC 4 cut(s) 263, 302, 350, 398
EarI CTCTTC 1 cut(s) 33
Eco130I CCWWGG 3 cut(s) 277, 316, 364
Eco31I GGTCTC 4 cut(s) 250, 289, 337, 385
Eco47I GGWCC 1 cut(s) 500
Eco81I CCTNAGG 1 cut(s) 489
EcoRII CCWGG 1 cut(s) 118
EcoT14I CCWWGG 3 cut(s) 277, 316, 364
EcoT22I ATGCAT 1 cut(s) 547
ErhI CCWWGG 3 cut(s) 277, 316, 364
FaeI CATG 6 cut(s) 91, 281, 320, 368, 484, 545
FaiI YATR 8 cut(s) 89, 279, 318, 366, 414, 473, 482, 543
FatI CATG 6 cut(s) 87, 277, 316, 364, 480, 541
Fnu4HI GCNGC 1 cut(s) 515
Fsp4HI GCNGC 1 cut(s) 515
FspBI CTAG 1 cut(s) 458
GluI GCNGC 1 cut(s) 515
HaeIII GGCC 2 cut(s) 470, 562
Hin1II CATG 6 cut(s) 91, 281, 320, 368, 484, 545
HindIII AAGCTT 1 cut(s) 134
HinfI GANTC 3 cut(s) 62, 434, 461
HphI GGTGA 2 cut(s) 332, 380
Hpy166II GTNNAC 1 cut(s) 48
Hpy188I TCNGA 1 cut(s) 178
Hpy188III TCNNGA 2 cut(s) 66, 438
Hpy8I GTNNAC 1 cut(s) 48
HpyCH4III ACNGT 3 cut(s) 58, 150, 422
HpyCH4V TGCA 4 cut(s) 77, 204, 484, 545
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 115
HpyF3I CTNAG 4 cut(s) 22, 189, 465, 489
Hsp92II CATG 6 cut(s) 91, 281, 320, 368, 484, 545
Kzo9I GATC 2 cut(s) 169, 556
LguI GCTCTTC 1 cut(s) 33
LpnPI CCDG 8 cut(s) 63, 105, 132, 273, 312, 360, 408, 451
Lsp1109I GCAGC 1 cut(s) 501
MaeI CTAG 1 cut(s) 458
MaeIII GTNAC 9 cut(s) 265, 304, 320, 352, 368, 400, 416, 427, 476
MalI GATC 2 cut(s) 171, 558
MboI GATC 2 cut(s) 169, 556
MboII GAAGA 1 cut(s) 20
MluCI AATT 6 cut(s) 94, 230, 270, 309, 357, 405
MlyI GAGTC 2 cut(s) 443, 470
MnlI CCTC 1 cut(s) 74
Mph1103I ATGCAT 1 cut(s) 547
MseI TTAA 2 cut(s) 102, 447
MspR9I CCNGG 1 cut(s) 120
MvaI CCWGG 1 cut(s) 120
MwoI GCNNNNNNNGC 2 cut(s) 23, 115
NcoI CCATGG 3 cut(s) 277, 316, 364
NdeII GATC 2 cut(s) 169, 556
NlaIII CATG 6 cut(s) 91, 281, 320, 368, 484, 545
NmuCI GTSAC 7 cut(s) 265, 304, 320, 352, 368, 400, 416
NsiI ATGCAT 1 cut(s) 547
NspI RCATGY 2 cut(s) 484, 545
PaeI GCATGC 1 cut(s) 545
PciSI GCTCTTC 1 cut(s) 33
PfeI GAWTC 1 cut(s) 62
PflFI GACNNNGTC 2 cut(s) 326, 374
PkrI GCNGC 1 cut(s) 516
PleI GAGTC 2 cut(s) 442, 469
PpsI GAGTC 2 cut(s) 442, 469
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
PspPI GGNCC 1 cut(s) 500
PsyI GACNNNGTC 2 cut(s) 326, 374
SapI GCTCTTC 1 cut(s) 33
SaqAI TTAA 2 cut(s) 102, 447
SatI GCNGC 1 cut(s) 515
Sau3AI GATC 2 cut(s) 169, 556
Sau96I GGNCC 1 cut(s) 500
SchI GAGTC 2 cut(s) 443, 470
ScrFI CCNGG 1 cut(s) 120
SinI GGWCC 1 cut(s) 500
SphI GCATGC 1 cut(s) 545
Sse9I AATT 6 cut(s) 94, 230, 270, 309, 357, 405
SspMI CTAG 1 cut(s) 458
StyD4I CCNGG 1 cut(s) 118
StyI CCWWGG 3 cut(s) 277, 316, 364
TaaI ACNGT 3 cut(s) 58, 150, 422
TaqI TCGA 3 cut(s) 243, 330, 378
TasI AATT 6 cut(s) 94, 230, 270, 309, 357, 405
TfiI GAWTC 1 cut(s) 62
Tru1I TTAA 2 cut(s) 102, 447
Tru9I TTAA 2 cut(s) 102, 447
TscAI CASTG 2 cut(s) 232, 427
TseFI GTSAC 7 cut(s) 265, 304, 320, 352, 368, 400, 416
TseI GCWGC 1 cut(s) 514
Tsp45I GTSAC 7 cut(s) 265, 304, 320, 352, 368, 400, 416
TspDTI ATGAA 3 cut(s) 17, 104, 222
TspGWI ACGGA 1 cut(s) 145
TspRI CASTG 2 cut(s) 232, 427
Tth111I GACNNNGTC 2 cut(s) 326, 374
VpaK11BI GGWCC 1 cut(s) 500
XapI RAATTY 2 cut(s) 94, 230
XceI RCATGY 2 cut(s) 484, 545
XspI CTAG 1 cut(s) 458
Zsp2I ATGCAT 1 cut(s) 547
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.