Rroxscaffold_7G00203780

Organ-specific protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0001115
Physical Location & Seq
Reverse (-)
52716785 .. 52717321
537 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00203780.1

Sequence Viewer

Length: 537 bp
ATGAAAAATTCCATTAAAAAGCCCACGCCAGGAGACTTACGGAAGCTCGTAAAAGAACAGTTTGAGCTTAACAATGCTGATCTATCTGATGATAAGACTGAGAAAGCCAACTGCAATGAAAATGGGAAACCCAACACTGAATTTGAGATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACATTGTCGAGTTTGAACCGAGACCTGATGCCACAATTTACCATGGTGACAGTGAAGTAACAGAGTCCAGAACTCTTAAAGACGAGCTAGAGTCTAAGGCCATGGTTAACATGCACCCTAAGGATAATGGTCCTAAAGATAAGCTGCCACTTGAAGTCAAAGCCAAAAGGCATGCATTTGAAGTAGATCGGCCAAATGTTTCTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Organ_specific

Protein Analysis

178

Amino Acids

20.44

Weight (kDa)

4.85

Isoelectric Point (pI)

23.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Organ_specific PF10950 8 - 107 1.1e-08 Organ specific protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 518
AcsI RAATTY 2 cut(s) 7, 140
AfiI CCNNNNNNNGG 1 cut(s) 29
AgsI TTSAA 7 cut(s) 161, 209, 257, 296, 344, 482, 509
AhdI GACNNNNNGTC 4 cut(s) 173, 221, 269, 308
AjnI CCWGG 1 cut(s) 28
AluBI AGCT 4 cut(s) 46, 67, 415, 472
AluI AGCT 4 cut(s) 46, 67, 415, 472
Alw26I GTCTC 6 cut(s) 27, 160, 208, 256, 295, 343
AoxI GGCC 2 cut(s) 426, 518
ApeKI GCWGC 1 cut(s) 472
ApoI RAATTY 2 cut(s) 7, 140
AspS9I GGNCC 1 cut(s) 458
AsuHPI GGTGA 5 cut(s) 203, 251, 299, 338, 386
AvaII GGWCC 1 cut(s) 458
AxyI CCTNAGG 1 cut(s) 447
BbvI GCAGC 1 cut(s) 459
BciT130I CCWGG 1 cut(s) 30
BcoDI GTCTC 6 cut(s) 27, 160, 208, 256, 295, 343
BfaI CTAG 1 cut(s) 416
BisI GCNGC 1 cut(s) 473
BlsI GCNGC 1 cut(s) 474
Bme1390I CCNGG 1 cut(s) 30
Bme18I GGWCC 1 cut(s) 458
BmeRI GACNNNNNGTC 4 cut(s) 173, 221, 269, 308
BmgT120I GGNCC 1 cut(s) 458
BmrFI CCNGG 1 cut(s) 30
BmsI GCATC 1 cut(s) 346
BsaI GGTCTC 5 cut(s) 160, 208, 256, 295, 343
BsaJI CCNNGG 6 cut(s) 187, 235, 283, 322, 370, 429
Bsc4I CCNNNNNNNGG 1 cut(s) 29
Bse21I CCTNAGG 1 cut(s) 447
Bse3DI GCAATG 1 cut(s) 121
BseBI CCWGG 1 cut(s) 30
BseDI CCNNGG 6 cut(s) 187, 235, 283, 322, 370, 429
BseLI CCNNNNNNNGG 1 cut(s) 29
BseMI GCAATG 1 cut(s) 121
BseMII CTCAG 1 cut(s) 90
BseXI GCAGC 1 cut(s) 459
BshFI GGCC 2 cut(s) 428, 520
BslI CCNNNNNNNGG 1 cut(s) 29
BsmAI GTCTC 6 cut(s) 27, 160, 208, 256, 295, 343
BsnI GGCC 2 cut(s) 428, 520
Bso31I GGTCTC 5 cut(s) 160, 208, 256, 295, 343
Bsp143I GATC 2 cut(s) 79, 514
Bsp19I CCATGG 6 cut(s) 187, 235, 283, 322, 370, 429
BspANI GGCC 2 cut(s) 428, 520
BspCNI CTCAG 1 cut(s) 91
BspTNI GGTCTC 5 cut(s) 160, 208, 256, 295, 343
BsrDI GCAATG 1 cut(s) 121
BssECI CCNNGG 6 cut(s) 187, 235, 283, 322, 370, 429
BssMI GATC 2 cut(s) 79, 514
BssT1I CCWWGG 6 cut(s) 187, 235, 283, 322, 370, 429
Bst2UI CCWGG 1 cut(s) 30
Bst4CI ACNGT 2 cut(s) 60, 380
BstC8I GCNNGC 1 cut(s) 501
BstDEI CTNAG 3 cut(s) 99, 423, 447
BstDSI CCRYGG 6 cut(s) 187, 235, 283, 322, 370, 429
BstKTI GATC 2 cut(s) 82, 517
BstMAI GTCTC 6 cut(s) 27, 160, 208, 256, 295, 343
BstMBI GATC 2 cut(s) 79, 514
BstNI CCWGG 1 cut(s) 30
BstNSI RCATGY 2 cut(s) 442, 503
BstSCI CCNGG 1 cut(s) 28
BstV1I GCAGC 1 cut(s) 459
Bsu36I CCTNAGG 1 cut(s) 447
BsuRI GGCC 2 cut(s) 428, 520
BtgI CCRYGG 6 cut(s) 187, 235, 283, 322, 370, 429
BtsIMutI CAGTG 2 cut(s) 135, 385
Cac8I GCNNGC 1 cut(s) 501
Cfr13I GGNCC 1 cut(s) 458
CviAII CATG 8 cut(s) 188, 236, 284, 323, 371, 430, 439, 500
CviJI RGCY 9 cut(s) 22, 46, 67, 107, 415, 428, 472, 491, 520
CviKI_1 RGCY 9 cut(s) 22, 46, 67, 107, 415, 428, 472, 491, 520
DdeI CTNAG 3 cut(s) 99, 423, 447
DpnI GATC 2 cut(s) 81, 516
DpnII GATC 2 cut(s) 79, 514
DriI GACNNNNNGTC 4 cut(s) 173, 221, 269, 308
EaeI YGGCCR 1 cut(s) 518
Eam1105I GACNNNNNGTC 4 cut(s) 173, 221, 269, 308
Eco130I CCWWGG 6 cut(s) 187, 235, 283, 322, 370, 429
Eco31I GGTCTC 5 cut(s) 160, 208, 256, 295, 343
Eco47I GGWCC 1 cut(s) 458
Eco81I CCTNAGG 1 cut(s) 447
EcoRII CCWGG 1 cut(s) 28
EcoT14I CCWWGG 6 cut(s) 187, 235, 283, 322, 370, 429
EcoT22I ATGCAT 1 cut(s) 505
ErhI CCWWGG 6 cut(s) 187, 235, 283, 322, 370, 429
FaeI CATG 8 cut(s) 191, 239, 287, 326, 374, 433, 442, 503
FaiI YATR 8 cut(s) 189, 237, 285, 324, 372, 431, 440, 501
FatI CATG 8 cut(s) 187, 235, 283, 322, 370, 429, 438, 499
Fnu4HI GCNGC 1 cut(s) 473
Fsp4HI GCNGC 1 cut(s) 473
FspBI CTAG 1 cut(s) 416
GluI GCNGC 1 cut(s) 473
HaeIII GGCC 2 cut(s) 428, 520
Hin1II CATG 8 cut(s) 191, 239, 287, 326, 374, 433, 442, 503
HincII GTYRAC 1 cut(s) 436
HindII GTYRAC 1 cut(s) 436
HinfI GANTC 2 cut(s) 392, 419
HpaI GTTAAC 1 cut(s) 436
HphI GGTGA 5 cut(s) 203, 251, 299, 338, 386
Hpy166II GTNNAC 1 cut(s) 436
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 396
Hpy8I GTNNAC 1 cut(s) 436
HpyCH4III ACNGT 2 cut(s) 60, 380
HpyCH4V TGCA 3 cut(s) 114, 442, 503
HpyF3I CTNAG 3 cut(s) 99, 423, 447
Hsp92II CATG 8 cut(s) 191, 239, 287, 326, 374, 433, 442, 503
KspAI GTTAAC 1 cut(s) 436
Kzo9I GATC 2 cut(s) 79, 514
LpnPI CCDG 8 cut(s) 15, 42, 183, 231, 279, 318, 366, 409
Lsp1109I GCAGC 1 cut(s) 459
LweI GCATC 1 cut(s) 346
MaeI CTAG 1 cut(s) 416
MalI GATC 2 cut(s) 81, 516
MboI GATC 2 cut(s) 79, 514
MluCI AATT 7 cut(s) 7, 140, 180, 228, 276, 315, 363
MlyI GAGTC 2 cut(s) 401, 428
Mph1103I ATGCAT 1 cut(s) 505
MseI TTAA 4 cut(s) 15, 69, 405, 435
MspR9I CCNGG 1 cut(s) 30
MvaI CCWGG 1 cut(s) 30
NcoI CCATGG 6 cut(s) 187, 235, 283, 322, 370, 429
NdeII GATC 2 cut(s) 79, 514
NlaIII CATG 8 cut(s) 191, 239, 287, 326, 374, 433, 442, 503
NmuCI GTSAC 9 cut(s) 175, 191, 223, 239, 271, 287, 310, 326, 374
NsiI ATGCAT 1 cut(s) 505
NspI RCATGY 2 cut(s) 442, 503
PaeI GCATGC 1 cut(s) 503
PflFI GACNNNGTC 3 cut(s) 197, 245, 332
PkrI GCNGC 1 cut(s) 474
PleI GAGTC 2 cut(s) 400, 427
PpsI GAGTC 2 cut(s) 400, 427
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
PspPI GGNCC 1 cut(s) 458
PsyI GACNNNGTC 3 cut(s) 197, 245, 332
SaqAI TTAA 4 cut(s) 15, 69, 405, 435
SatI GCNGC 1 cut(s) 473
Sau3AI GATC 2 cut(s) 79, 514
Sau96I GGNCC 1 cut(s) 458
SchI GAGTC 2 cut(s) 401, 428
ScrFI CCNGG 1 cut(s) 30
SetI ASST 9 cut(s) 48, 69, 172, 220, 268, 307, 355, 417, 474
SfaNI GCATC 1 cut(s) 346
SinI GGWCC 1 cut(s) 458
SphI GCATGC 1 cut(s) 503
Sse9I AATT 7 cut(s) 7, 140, 180, 228, 276, 315, 363
SspMI CTAG 1 cut(s) 416
StyD4I CCNGG 1 cut(s) 28
StyI CCWWGG 6 cut(s) 187, 235, 283, 322, 370, 429
TaaI ACNGT 2 cut(s) 60, 380
TaqI TCGA 4 cut(s) 153, 201, 249, 336
TasI AATT 7 cut(s) 7, 140, 180, 228, 276, 315, 363
Tru1I TTAA 4 cut(s) 15, 69, 405, 435
Tru9I TTAA 4 cut(s) 15, 69, 405, 435
TscAI CASTG 2 cut(s) 142, 385
TseFI GTSAC 9 cut(s) 175, 191, 223, 239, 271, 287, 310, 326, 374
TseI GCWGC 1 cut(s) 472
Tsp45I GTSAC 9 cut(s) 175, 191, 223, 239, 271, 287, 310, 326, 374
TspDTI ATGAA 2 cut(s) 17, 132
TspGWI ACGGA 1 cut(s) 55
TspRI CASTG 2 cut(s) 142, 385
Tth111I GACNNNGTC 3 cut(s) 197, 245, 332
VpaK11BI GGWCC 1 cut(s) 458
XapI RAATTY 2 cut(s) 7, 140
XceI RCATGY 2 cut(s) 442, 503
XspI CTAG 1 cut(s) 416
Zsp2I ATGCAT 1 cut(s) 505
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.