Rroxscaffold_176G00431330

Organ-specific protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000176
Physical Location & Seq
Forward (+)
929912 .. 930726
815 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_176G00431330.1

Sequence Viewer

Length: 417 bp
ATGAACTCCCTTTGTGCCATCTTAGCTGTTCTCTCATTTCTTTTGTTCACTACAACTATAGAATCGTCAAGAATAGTTGCAGGAGGCTACAAGGAAAATACTATTGAAAGGCAGCCCATGCCACAAAACTTATGGCAACTCATGAAAGAACAACTTGACATTGATAATGTTGATCTTTCTGATGATAAAGATGAGAAACCCGACTGCCATGATCTGAAACCTAGCATTGAGTTTGATATGGTTGAGTTAAAATGGGATAAATACAATGATGGTGAAGTAGTAAAATCCAGTACTCTTGAAGACAAGCCTGATTCTGTTAAGGAAATTGGTTACATGCGCCCAAACAATGATGGTCATGAAGAAATGCAGCCATTTGAAGCCGAAGCCAACATGAATGCATCTGATGAAGACTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

15.82

Weight (kDa)

4.22

Isoelectric Point (pI)

45.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 292
AgsI TTSAA 3 cut(s) 107, 299, 377
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
ApeKI GCWGC 2 cut(s) 112, 367
AspLEI GCGC 1 cut(s) 339
AsuHPI GGTGA 1 cut(s) 284
BbsI GAAGAC 1 cut(s) 306
BbvI GCAGC 2 cut(s) 124, 379
BccI CCATC 3 cut(s) 26, 263, 344
BfaI CTAG 1 cut(s) 222
BfmI CTRYAG 1 cut(s) 57
BisI GCNGC 2 cut(s) 113, 368
BlsI GCNGC 2 cut(s) 114, 369
BmcAI AGTACT 1 cut(s) 292
BmsI GCATC 1 cut(s) 407
BpiI GAAGAC 1 cut(s) 306
Bse1I ACTGG 1 cut(s) 288
BseNI ACTGG 1 cut(s) 288
BseXI GCAGC 2 cut(s) 124, 379
BsmI GAATGC 1 cut(s) 400
Bsp143I GATC 2 cut(s) 172, 211
BspHI TCATGA 2 cut(s) 141, 355
BsrI ACTGG 1 cut(s) 288
BssMI GATC 2 cut(s) 172, 211
BstAPI GCANNNNNTGC 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 22
BstHHI GCGC 1 cut(s) 339
BstKTI GATC 2 cut(s) 175, 214
BstMBI GATC 2 cut(s) 172, 211
BstMWI GCNNNNNNNGC 2 cut(s) 23, 118
BstNSI RCATGY 1 cut(s) 337
BstSFI CTRYAG 1 cut(s) 57
BstV1I GCAGC 2 cut(s) 124, 379
BstV2I GAAGAC 1 cut(s) 306
CciI TCATGA 2 cut(s) 141, 355
CfoI GCGC 1 cut(s) 339
Csp6I GTAC 1 cut(s) 291
CviAII CATG 6 cut(s) 118, 142, 209, 334, 356, 391
CviJI RGCY 7 cut(s) 26, 87, 115, 307, 370, 380, 386
CviKI_1 RGCY 7 cut(s) 26, 87, 115, 307, 370, 380, 386
CviQI GTAC 1 cut(s) 291
DdeI CTNAG 1 cut(s) 22
DpnI GATC 2 cut(s) 174, 213
DpnII GATC 2 cut(s) 172, 211
EcoT22I ATGCAT 1 cut(s) 400
FaeI CATG 6 cut(s) 121, 145, 212, 337, 359, 394
FaiI YATR 9 cut(s) 59, 119, 133, 143, 210, 239, 335, 357, 392
FalI AAGNNNNNCTT 2 cut(s) 138, 170
FatI CATG 6 cut(s) 117, 141, 208, 333, 355, 390
Fnu4HI GCNGC 2 cut(s) 113, 368
Fsp4HI GCNGC 2 cut(s) 113, 368
FspBI CTAG 1 cut(s) 222
GlaI GCGC 1 cut(s) 338
GluI GCNGC 2 cut(s) 113, 368
HhaI GCGC 1 cut(s) 339
Hin1II CATG 6 cut(s) 121, 145, 212, 337, 359, 394
Hin6I GCGC 1 cut(s) 337
HinP1I GCGC 1 cut(s) 337
HinfI GANTC 2 cut(s) 62, 311
HphI GGTGA 1 cut(s) 284
Hpy166II GTNNAC 1 cut(s) 48
Hpy188I TCNGA 3 cut(s) 181, 216, 403
Hpy188III TCNNGA 4 cut(s) 69, 142, 296, 356
Hpy8I GTNNAC 1 cut(s) 48
HpyCH4V TGCA 3 cut(s) 80, 367, 398
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 118
HpyF3I CTNAG 1 cut(s) 22
Hsp92II CATG 6 cut(s) 121, 145, 212, 337, 359, 394
HspAI GCGC 1 cut(s) 337
Kzo9I GATC 2 cut(s) 172, 211
LpnPI CCDG 3 cut(s) 66, 301, 321
Lsp1109I GCAGC 2 cut(s) 124, 379
LweI GCATC 1 cut(s) 407
MaeI CTAG 1 cut(s) 222
MaeIII GTNAC 1 cut(s) 329
MalI GATC 2 cut(s) 174, 213
MboI GATC 2 cut(s) 172, 211
MboII GAAGA 2 cut(s) 311, 371
MluCI AATT 1 cut(s) 324
MnlI CCTC 1 cut(s) 77
Mph1103I ATGCAT 1 cut(s) 400
MseI TTAA 2 cut(s) 248, 318
Mva1269I GAATGC 1 cut(s) 400
MwoI GCNNNNNNNGC 2 cut(s) 23, 118
NdeII GATC 2 cut(s) 172, 211
NlaIII CATG 6 cut(s) 121, 145, 212, 337, 359, 394
NsiI ATGCAT 1 cut(s) 400
NspI RCATGY 1 cut(s) 337
PagI TCATGA 2 cut(s) 141, 355
PctI GAATGC 1 cut(s) 400
PfeI GAWTC 2 cut(s) 62, 311
PkrI GCNGC 2 cut(s) 114, 369
RsaI GTAC 1 cut(s) 292
RsaNI GTAC 1 cut(s) 291
SaqAI TTAA 2 cut(s) 248, 318
SatI GCNGC 2 cut(s) 113, 368
Sau3AI GATC 2 cut(s) 172, 211
ScaI AGTACT 1 cut(s) 292
SetI ASST 2 cut(s) 28, 223
SfaNI GCATC 1 cut(s) 407
SfcI CTRYAG 1 cut(s) 57
Sse9I AATT 1 cut(s) 324
SspMI CTAG 1 cut(s) 222
TasI AATT 1 cut(s) 324
TatI WGTACW 1 cut(s) 290
TfiI GAWTC 2 cut(s) 62, 311
Tru1I TTAA 2 cut(s) 248, 318
Tru9I TTAA 2 cut(s) 248, 318
TseI GCWGC 2 cut(s) 112, 367
TspDTI ATGAA 4 cut(s) 17, 158, 372, 407
XceI RCATGY 1 cut(s) 337
XcmI CCANNNNNNNNNTGG 1 cut(s) 129
XspI CTAG 1 cut(s) 222
ZrmI AGTACT 1 cut(s) 292
Zsp2I ATGCAT 1 cut(s) 400
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.