Rroxscaffold_7G00203700

Organ-specific protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0001115
Physical Location & Seq
Forward (+)
52605166 .. 52606025
860 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00203700.1

Sequence Viewer

Length: 510 bp
ATGAACTCCCTTTATGCCATCTTAGCTCTCCTCTCATTTCTTTTGTTCACTACAACTGTACGTTCAAGAATAGGTGCAGGAGGCTACATGAAAAATTCCATTGAAAGGCAACCCACGCCAGCAGACTCATGGAAGCTCGTAAAAGAACAGGTTGAGCTTAACAATGCTGATCTATCTGATGATAAGGCTGAGAAAGCCAACTGCAATGAAAATGGGAAACCTAACAGTGAATTTGGGATTGTCGAGTTTGAACCGAGACCTGATGTCACAATTTACCATGGTGACATTGTCGAGTTTGAACCGAGACCTGATATCACAATTTATCATGGTGACAGTGAAGTAACAGAGTCCAGAACTCTTAAAGACGAGCTAGAGTCGAAGGCCAAAGGTAACATGCACCCTAAGGATAAAGGTCCTAAAGATAAGCTGCCATTTGAAGTCAAAGCCAAAAGGTATGCATTTGAAGAAGATTTTGAGCCAAGGCCAAATATTTCTGTGTACAATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Organ_specific

Protein Analysis

169

Amino Acids

19.2

Weight (kDa)

5.02

Isoelectric Point (pI)

41.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Organ_specific PF10950 98 - 168 5.1e-07 Organ specific protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 94, 230
AfaI GTAC 2 cut(s) 60, 500
AfiI CCNNNNNNNGG 1 cut(s) 105
AgsI TTSAA 6 cut(s) 66, 104, 251, 299, 437, 464
AhdI GACNNNNNGTC 1 cut(s) 263
AluBI AGCT 5 cut(s) 26, 136, 157, 370, 427
AluI AGCT 5 cut(s) 26, 136, 157, 370, 427
Alw26I GTCTC 2 cut(s) 250, 298
AoxI GGCC 2 cut(s) 381, 482
ApeKI GCWGC 1 cut(s) 427
ApoI RAATTY 2 cut(s) 94, 230
AspS9I GGNCC 1 cut(s) 413
AsuHPI GGTGA 2 cut(s) 293, 341
AvaII GGWCC 1 cut(s) 413
AxyI CCTNAGG 1 cut(s) 402
BbvI GCAGC 1 cut(s) 414
BccI CCATC 1 cut(s) 26
BcoDI GTCTC 2 cut(s) 250, 298
BfaI CTAG 1 cut(s) 371
BisI GCNGC 1 cut(s) 428
BlsI GCNGC 1 cut(s) 429
Bme18I GGWCC 1 cut(s) 413
BmeRI GACNNNNNGTC 1 cut(s) 263
BmgT120I GGNCC 1 cut(s) 413
BsaI GGTCTC 2 cut(s) 250, 298
BsaJI CCNNGG 2 cut(s) 277, 479
Bsc4I CCNNNNNNNGG 1 cut(s) 105
Bse21I CCTNAGG 1 cut(s) 402
Bse3DI GCAATG 1 cut(s) 211
BseDI CCNNGG 2 cut(s) 277, 479
BseLI CCNNNNNNNGG 1 cut(s) 105
BseMI GCAATG 1 cut(s) 211
BseMII CTCAG 1 cut(s) 180
BseRI GAGGAG 1 cut(s) 20
BseXI GCAGC 1 cut(s) 414
BsgI GTGCAG 1 cut(s) 96
BshFI GGCC 2 cut(s) 383, 484
BslI CCNNNNNNNGG 1 cut(s) 105
BsmAI GTCTC 2 cut(s) 250, 298
BsnI GGCC 2 cut(s) 383, 484
Bso31I GGTCTC 2 cut(s) 250, 298
Bsp1407I TGTACA 1 cut(s) 498
Bsp143I GATC 1 cut(s) 169
Bsp19I CCATGG 1 cut(s) 277
BspANI GGCC 2 cut(s) 383, 484
BspCNI CTCAG 1 cut(s) 181
BspTNI GGTCTC 2 cut(s) 250, 298
BsrDI GCAATG 1 cut(s) 211
BsrGI TGTACA 1 cut(s) 498
BssECI CCNNGG 2 cut(s) 277, 479
BssMI GATC 1 cut(s) 169
BssT1I CCWWGG 2 cut(s) 277, 479
Bst4CI ACNGT 3 cut(s) 58, 227, 335
BstAUI TGTACA 1 cut(s) 498
BstC8I GCNNGC 1 cut(s) 120
BstDEI CTNAG 3 cut(s) 22, 189, 402
BstDSI CCRYGG 1 cut(s) 277
BstKTI GATC 1 cut(s) 172
BstMAI GTCTC 2 cut(s) 250, 298
BstMBI GATC 1 cut(s) 169
BstMWI GCNNNNNNNGC 3 cut(s) 23, 115, 194
BstNSI RCATGY 1 cut(s) 397
BstV1I GCAGC 1 cut(s) 414
Bsu36I CCTNAGG 1 cut(s) 402
BsuRI GGCC 2 cut(s) 383, 484
BtgI CCRYGG 1 cut(s) 277
BtsIMutI CAGTG 2 cut(s) 232, 340
Cac8I GCNNGC 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 413
Csp6I GTAC 2 cut(s) 59, 499
CviAII CATG 5 cut(s) 88, 129, 278, 326, 394
CviQI GTAC 2 cut(s) 59, 499
DdeI CTNAG 3 cut(s) 22, 189, 402
DpnI GATC 1 cut(s) 171
DpnII GATC 1 cut(s) 169
DriI GACNNNNNGTC 1 cut(s) 263
Eam1105I GACNNNNNGTC 1 cut(s) 263
Eco130I CCWWGG 2 cut(s) 277, 479
Eco31I GGTCTC 2 cut(s) 250, 298
Eco32I GATATC 1 cut(s) 313
Eco47I GGWCC 1 cut(s) 413
Eco81I CCTNAGG 1 cut(s) 402
EcoO109I RGGNCCY 1 cut(s) 413
EcoRV GATATC 1 cut(s) 313
EcoT14I CCWWGG 2 cut(s) 277, 479
EcoT22I ATGCAT 1 cut(s) 460
ErhI CCWWGG 2 cut(s) 277, 479
FaeI CATG 5 cut(s) 91, 132, 281, 329, 397
FaiI YATR 7 cut(s) 15, 89, 130, 279, 327, 395, 456
FatI CATG 5 cut(s) 87, 128, 277, 325, 393
Fnu4HI GCNGC 1 cut(s) 428
Fsp4HI GCNGC 1 cut(s) 428
FspBI CTAG 1 cut(s) 371
GluI GCNGC 1 cut(s) 428
HaeIII GGCC 2 cut(s) 383, 484
Hin1II CATG 5 cut(s) 91, 132, 281, 329, 397
HinfI GANTC 3 cut(s) 125, 347, 374
HphI GGTGA 2 cut(s) 293, 341
Hpy166II GTNNAC 2 cut(s) 48, 499
Hpy188I TCNGA 1 cut(s) 178
Hpy188III TCNNGA 2 cut(s) 66, 351
Hpy8I GTNNAC 2 cut(s) 48, 499
HpyAV CCTTC 1 cut(s) 373
HpyCH4III ACNGT 3 cut(s) 58, 227, 335
HpyCH4IV ACGT 1 cut(s) 61
HpyCH4V TGCA 4 cut(s) 77, 204, 397, 458
HpyF10VI GCNNNNNNNGC 3 cut(s) 23, 115, 194
HpyF3I CTNAG 3 cut(s) 22, 189, 402
HpySE526I ACGT 1 cut(s) 61
Hsp92II CATG 5 cut(s) 91, 132, 281, 329, 397
Kzo9I GATC 1 cut(s) 169
LpnPI CCDG 6 cut(s) 63, 132, 134, 273, 321, 364
Lsp1109I GCAGC 1 cut(s) 414
MaeI CTAG 1 cut(s) 371
MaeII ACGT 1 cut(s) 61
MaeIII GTNAC 5 cut(s) 265, 281, 329, 340, 389
MalI GATC 1 cut(s) 171
MboI GATC 1 cut(s) 169
MboII GAAGA 2 cut(s) 476, 479
MluCI AATT 4 cut(s) 94, 230, 270, 318
MlyI GAGTC 3 cut(s) 119, 356, 383
MnlI CCTC 2 cut(s) 41, 74
Mph1103I ATGCAT 1 cut(s) 460
MseI TTAA 2 cut(s) 159, 360
MwoI GCNNNNNNNGC 3 cut(s) 23, 115, 194
NcoI CCATGG 1 cut(s) 277
NdeII GATC 1 cut(s) 169
NlaIII CATG 5 cut(s) 91, 132, 281, 329, 397
NmuCI GTSAC 3 cut(s) 265, 281, 329
NsiI ATGCAT 1 cut(s) 460
NspI RCATGY 1 cut(s) 397
PflFI GACNNNGTC 1 cut(s) 287
PkrI GCNGC 1 cut(s) 429
PleI GAGTC 3 cut(s) 119, 355, 382
PpsI GAGTC 3 cut(s) 119, 355, 382
PpuMI RGGWCCY 1 cut(s) 413
Psp5II RGGWCCY 1 cut(s) 413
PspPI GGNCC 1 cut(s) 413
PspPPI RGGWCCY 1 cut(s) 413
PsyI GACNNNGTC 1 cut(s) 287
RsaI GTAC 2 cut(s) 60, 500
RsaNI GTAC 2 cut(s) 59, 499
SaqAI TTAA 2 cut(s) 159, 360
SatI GCNGC 1 cut(s) 428
Sau3AI GATC 1 cut(s) 169
Sau96I GGNCC 1 cut(s) 413
SchI GAGTC 3 cut(s) 119, 356, 383
SinI GGWCC 1 cut(s) 413
Sse9I AATT 4 cut(s) 94, 230, 270, 318
SspI AATATT 1 cut(s) 490
SspMI CTAG 1 cut(s) 371
StyI CCWWGG 2 cut(s) 277, 479
TaaI ACNGT 3 cut(s) 58, 227, 335
TaiI ACGT 1 cut(s) 64
TaqI TCGA 3 cut(s) 243, 291, 377
TasI AATT 4 cut(s) 94, 230, 270, 318
TatI WGTACW 1 cut(s) 498
Tru1I TTAA 2 cut(s) 159, 360
Tru9I TTAA 2 cut(s) 159, 360
TscAI CASTG 2 cut(s) 232, 340
TseFI GTSAC 3 cut(s) 265, 281, 329
TseI GCWGC 1 cut(s) 427
Tsp45I GTSAC 3 cut(s) 265, 281, 329
TspDTI ATGAA 3 cut(s) 17, 104, 222
TspRI CASTG 2 cut(s) 232, 340
Tth111I GACNNNGTC 1 cut(s) 287
VpaK11BI GGWCC 1 cut(s) 413
XapI RAATTY 2 cut(s) 94, 230
XceI RCATGY 1 cut(s) 397
XcmI CCANNNNNNNNNTGG 1 cut(s) 126
XspI CTAG 1 cut(s) 371
Zsp2I ATGCAT 1 cut(s) 460
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.