Rh6BG041500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0001115
Physical Location & Seq
Reverse (-)
6749435 .. 6768945
19511 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG041500.1

Sequence Viewer

Length: 246 bp
ATGCCCAGAAAATTAATGTTGCTGAAACTTCCTAACGACGTCGATAGGCGCTGGTTGGTGAGGTTTGTCTTGCCTCTGTTGGTGAGCGTTGTTCAGAATGTATCTGAGAAGGTGTCGGAGCGAGCTAAGAGGGCCTTACGATCGGTTCTCCCAATTGCAATCCCCACCGAGTTGGCGAGCTTGAAAGGACTGTCCGAAGCAGCTTCTTATATTGATAGTGCTGTTCATGTTGAGGCTGAAGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.03

Weight (kDa)

9.69

Isoelectric Point (pI)

51.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 42
AcyI GRCGYC 1 cut(s) 39
AgsI TTSAA 1 cut(s) 184
AluBI AGCT 3 cut(s) 125, 180, 203
AluI AGCT 3 cut(s) 125, 180, 203
AoxI GGCC 1 cut(s) 132
ApeKI GCWGC 1 cut(s) 200
AseI ATTAAT 1 cut(s) 14
AspLEI GCGC 1 cut(s) 51
AspS9I GGNCC 1 cut(s) 132
AsuHPI GGTGA 2 cut(s) 70, 94
BbvI GCAGC 1 cut(s) 212
BfoI RGCGCY 1 cut(s) 52
BisI GCNGC 1 cut(s) 201
BlsI GCNGC 1 cut(s) 202
BmgT120I GGNCC 1 cut(s) 132
BsaHI GRCGYC 1 cut(s) 39
BseMII CTCAG 1 cut(s) 96
BseXI GCAGC 1 cut(s) 212
Bsh1285I CGRYCG 1 cut(s) 143
BshFI GGCC 1 cut(s) 134
BsiEI CGRYCG 1 cut(s) 143
BsnI GGCC 1 cut(s) 134
Bsp143I GATC 1 cut(s) 140
BspANI GGCC 1 cut(s) 134
BspCNI CTCAG 1 cut(s) 97
BssMI GATC 1 cut(s) 140
BssNI GRCGYC 1 cut(s) 39
Bst4CI ACNGT 1 cut(s) 192
BstACI GRCGYC 1 cut(s) 39
BstC8I GCNNGC 2 cut(s) 123, 178
BstDEI CTNAG 2 cut(s) 105, 126
BstH2I RGCGCY 1 cut(s) 52
BstHHI GCGC 1 cut(s) 51
BstKTI GATC 1 cut(s) 143
BstMBI GATC 1 cut(s) 140
BstMCI CGRYCG 1 cut(s) 143
BstMWI GCNNNNNNNGC 1 cut(s) 131
BstV1I GCAGC 1 cut(s) 212
BstXI CCANNNNNNTGG 1 cut(s) 172
BsuRI GGCC 1 cut(s) 134
Cac8I GCNNGC 2 cut(s) 123, 178
CfoI GCGC 1 cut(s) 51
Cfr13I GGNCC 1 cut(s) 132
CviAII CATG 1 cut(s) 227
CviJI RGCY 5 cut(s) 125, 134, 180, 203, 236
CviKI_1 RGCY 5 cut(s) 125, 134, 180, 203, 236
DdeI CTNAG 2 cut(s) 105, 126
DpnI GATC 1 cut(s) 142
DpnII GATC 1 cut(s) 140
EcoO109I RGGNCCY 1 cut(s) 132
FaeI CATG 1 cut(s) 230
FaiI YATR 2 cut(s) 210, 228
FalI AAGNNNNNCTT 2 cut(s) 119, 151
FatI CATG 1 cut(s) 226
Fnu4HI GCNGC 1 cut(s) 201
Fsp4HI GCNGC 1 cut(s) 201
GlaI GCGC 1 cut(s) 50
GluI GCNGC 1 cut(s) 201
HaeII RGCGCY 1 cut(s) 52
HaeIII GGCC 1 cut(s) 134
HhaI GCGC 1 cut(s) 51
Hin1I GRCGYC 1 cut(s) 39
Hin1II CATG 1 cut(s) 230
Hin6I GCGC 1 cut(s) 49
HinP1I GCGC 1 cut(s) 49
HphI GGTGA 2 cut(s) 70, 94
Hpy188I TCNGA 4 cut(s) 96, 106, 118, 196
Hpy99I CGWCG 2 cut(s) 41, 44
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 1 cut(s) 192
HpyCH4IV ACGT 1 cut(s) 39
HpyCH4V TGCA 1 cut(s) 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
HpyF3I CTNAG 2 cut(s) 105, 126
HpySE526I ACGT 1 cut(s) 39
Hsp92I GRCGYC 1 cut(s) 39
Hsp92II CATG 1 cut(s) 230
HspAI GCGC 1 cut(s) 49
Kzo9I GATC 1 cut(s) 140
LmnI GCTCC 1 cut(s) 118
LpnPI CCDG 2 cut(s) 19, 37
Lsp1109I GCAGC 1 cut(s) 212
MaeII ACGT 1 cut(s) 39
MalI GATC 1 cut(s) 142
MboI GATC 1 cut(s) 140
MfeI CAATTG 1 cut(s) 153
MluCI AATT 2 cut(s) 11, 153
MmeI TCCRAC 1 cut(s) 96
MnlI CCTC 4 cut(s) 54, 84, 123, 226
MseI TTAA 1 cut(s) 14
MunI CAATTG 1 cut(s) 153
MwoI GCNNNNNNNGC 1 cut(s) 131
NdeII GATC 1 cut(s) 140
NlaIII CATG 1 cut(s) 230
PkrI GCNGC 1 cut(s) 202
Ple19I CGATCG 1 cut(s) 143
PshBI ATTAAT 1 cut(s) 14
PspPI GGNCC 1 cut(s) 132
PvuI CGATCG 1 cut(s) 143
SaqAI TTAA 1 cut(s) 14
SatI GCNGC 1 cut(s) 201
Sau3AI GATC 1 cut(s) 140
Sau96I GGNCC 1 cut(s) 132
SetI ASST 6 cut(s) 42, 65, 114, 127, 182, 205
SgeI CNNG 8 cut(s) 18, 64, 82, 134, 181, 189, 193, 239
Sse9I AATT 2 cut(s) 11, 153
TaaI ACNGT 1 cut(s) 192
TaiI ACGT 1 cut(s) 42
TaqI TCGA 1 cut(s) 42
TasI AATT 2 cut(s) 11, 153
Tru1I TTAA 1 cut(s) 14
Tru9I TTAA 1 cut(s) 14
TseI GCWGC 1 cut(s) 200
TspDTI ATGAA 1 cut(s) 215
VspI ATTAAT 1 cut(s) 14
ZraI GACGTC 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.