Rh2CG233200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0001115
Physical Location & Seq
Forward (+)
23832825 .. 23844890
12066 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG233200.1

Sequence Viewer

Length: 189 bp
ATGTTGCAAGCGAGCTTGAAAGGACTGTCCGAAGAAGCTTCTTATATTGATAGTGCTGTTCATTTCAACTCATTTTATATCGTCCCAATTTCGAATGGGGTACTATCGAATCGCGTTAGATTTGACGGTCGTATTCACAATACATTCATTGACTTCAAAAATCAAGATCTAAGAGTCGAGCAAATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.12

Weight (kDa)

6.01

Isoelectric Point (pI)

39.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 114
AfaI GTAC 1 cut(s) 102
AgsI TTSAA 3 cut(s) 19, 67, 157
AluBI AGCT 2 cut(s) 15, 38
AluI AGCT 2 cut(s) 15, 38
AsuII TTCGAA 1 cut(s) 92
BglII AGATCT 1 cut(s) 166
Bpu14I TTCGAA 1 cut(s) 92
Bsh1236I CGCG 1 cut(s) 114
Bsh1285I CGRYCG 1 cut(s) 130
BsiEI CGRYCG 1 cut(s) 130
BslFI GGGAC 1 cut(s) 68
BsmFI GGGAC 1 cut(s) 68
Bsp119I TTCGAA 1 cut(s) 92
Bsp143I GATC 1 cut(s) 166
BspFNI CGCG 1 cut(s) 114
BspT104I TTCGAA 1 cut(s) 92
BssMI GATC 1 cut(s) 166
Bst4CI ACNGT 2 cut(s) 27, 128
BstBI TTCGAA 1 cut(s) 92
BstC8I GCNNGC 2 cut(s) 9, 13
BstDEI CTNAG 1 cut(s) 170
BstFNI CGCG 1 cut(s) 114
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstMCI CGRYCG 1 cut(s) 130
BstUI CGCG 1 cut(s) 114
BstX2I RGATCY 1 cut(s) 166
BstYI RGATCY 1 cut(s) 166
Cac8I GCNNGC 2 cut(s) 9, 13
Csp6I GTAC 1 cut(s) 101
CviJI RGCY 2 cut(s) 15, 38
CviKI_1 RGCY 2 cut(s) 15, 38
CviQI GTAC 1 cut(s) 101
DdeI CTNAG 1 cut(s) 170
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
FaiI YATR 2 cut(s) 45, 78
FaqI GGGAC 1 cut(s) 68
FspEI CC 8 cut(s) 6, 43, 81, 82, 83, 98, 99, 111
HindIII AAGCTT 1 cut(s) 36
HinfI GANTC 2 cut(s) 109, 174
Hpy188I TCNGA 1 cut(s) 31
Hpy188III TCNNGA 1 cut(s) 164
HpyCH4III ACNGT 2 cut(s) 27, 128
HpyCH4V TGCA 1 cut(s) 7
HpyF3I CTNAG 1 cut(s) 170
Kzo9I GATC 1 cut(s) 166
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 1 cut(s) 44
MflI RGATCY 1 cut(s) 166
MluCI AATT 1 cut(s) 87
MlyI GAGTC 1 cut(s) 183
MvnI CGCG 1 cut(s) 114
NdeII GATC 1 cut(s) 166
NspV TTCGAA 1 cut(s) 92
PfeI GAWTC 1 cut(s) 109
PleI GAGTC 1 cut(s) 182
PpsI GAGTC 1 cut(s) 182
PsuI RGATCY 1 cut(s) 166
RsaI GTAC 1 cut(s) 102
RsaNI GTAC 1 cut(s) 101
Sau3AI GATC 1 cut(s) 166
SchI GAGTC 1 cut(s) 183
SetI ASST 2 cut(s) 17, 40
SfuI TTCGAA 1 cut(s) 92
SgeI CNNG 5 cut(s) 20, 24, 28, 125, 176
Sse9I AATT 1 cut(s) 87
TaaI ACNGT 2 cut(s) 27, 128
TaqI TCGA 3 cut(s) 92, 107, 177
TasI AATT 1 cut(s) 87
TfiI GAWTC 1 cut(s) 109
TspDTI ATGAA 2 cut(s) 50, 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.