RLG00000014301

Organ-specific protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Reverse (-)
50969697 .. 50970535
839 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000014301

Sequence Viewer

Length: 447 bp
ATGAACTCCCTTTGTGCCATCTTAGCTGTTCTCTCATTTCTTTTGTTCACTACAACTATAGAATCATCAAGAATAGTTGCAGGAGGCTACAAGGAAAATGCTATTGAAAGGCAGCCCATGCCACAAAACTTATGGCAACTCATGAACGAACAACTTGACATTGATAATGTTGATCTTTCTGATGATAAAGATGAGAAACCCGACTGCCATGATCTGAAACCTAGCATTGAGTTTCATATGGTTGAGTTAAAATGGAATAAATACAATGATGGTGTAGTAAAATCCAGTACTCTTGAAGACAAGCCTGATTCTGTTAAGGAAATTGGTTACATGCGCCCAAACAATAATGGTCATGAAGAAATGCAGCCATTTGAAGCCGAAGCCAACATGAATGCATCTGATGAAGACTTTGAATCAAGGCTACATACTTCTGTTTATAATAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

149

Amino Acids

16.97

Weight (kDa)

4.46

Isoelectric Point (pI)

46.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 438
AfaI GTAC 1 cut(s) 289
AgsI TTSAA 4 cut(s) 107, 296, 374, 413
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
ApeKI GCWGC 2 cut(s) 112, 364
AspLEI GCGC 1 cut(s) 336
BbsI GAAGAC 2 cut(s) 303, 411
BbvI GCAGC 2 cut(s) 124, 376
BccI CCATC 2 cut(s) 26, 263
BfaI CTAG 1 cut(s) 222
BfmI CTRYAG 1 cut(s) 57
BisI GCNGC 2 cut(s) 113, 365
BlsI GCNGC 2 cut(s) 114, 366
BmcAI AGTACT 1 cut(s) 289
BmsI GCATC 1 cut(s) 404
BpiI GAAGAC 2 cut(s) 303, 411
Bse1I ACTGG 1 cut(s) 285
BseNI ACTGG 1 cut(s) 285
BseXI GCAGC 2 cut(s) 124, 376
BsmI GAATGC 1 cut(s) 397
Bsp143I GATC 2 cut(s) 172, 211
BspHI TCATGA 2 cut(s) 141, 352
BsrI ACTGG 1 cut(s) 285
BssMI GATC 2 cut(s) 172, 211
BstAPI GCANNNNNTGC 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 22
BstHHI GCGC 1 cut(s) 336
BstKTI GATC 2 cut(s) 175, 214
BstMBI GATC 2 cut(s) 172, 211
BstMWI GCNNNNNNNGC 2 cut(s) 23, 118
BstNSI RCATGY 1 cut(s) 334
BstSFI CTRYAG 1 cut(s) 57
BstV1I GCAGC 2 cut(s) 124, 376
BstV2I GAAGAC 2 cut(s) 303, 411
CciI TCATGA 2 cut(s) 141, 352
CfoI GCGC 1 cut(s) 336
Csp6I GTAC 1 cut(s) 288
CviAII CATG 6 cut(s) 118, 142, 209, 331, 353, 388
CviJI RGCY 8 cut(s) 26, 87, 115, 304, 367, 377, 383, 421
CviKI_1 RGCY 8 cut(s) 26, 87, 115, 304, 367, 377, 383, 421
CviQI GTAC 1 cut(s) 288
DdeI CTNAG 1 cut(s) 22
DpnI GATC 2 cut(s) 174, 213
DpnII GATC 2 cut(s) 172, 211
EcoT22I ATGCAT 1 cut(s) 397
FaeI CATG 6 cut(s) 121, 145, 212, 334, 356, 391
FatI CATG 6 cut(s) 117, 141, 208, 330, 352, 387
FauNDI CATATG 1 cut(s) 237
Fnu4HI GCNGC 2 cut(s) 113, 365
Fsp4HI GCNGC 2 cut(s) 113, 365
FspBI CTAG 1 cut(s) 222
GlaI GCGC 1 cut(s) 335
GluI GCNGC 2 cut(s) 113, 365
HhaI GCGC 1 cut(s) 336
Hin1II CATG 6 cut(s) 121, 145, 212, 334, 356, 391
Hin6I GCGC 1 cut(s) 334
HinP1I GCGC 1 cut(s) 334
HinfI GANTC 3 cut(s) 62, 308, 413
Hpy166II GTNNAC 1 cut(s) 48
Hpy188I TCNGA 3 cut(s) 181, 216, 400
Hpy188III TCNNGA 4 cut(s) 69, 142, 293, 353
Hpy8I GTNNAC 1 cut(s) 48
HpyCH4V TGCA 3 cut(s) 80, 364, 395
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 118
HpyF3I CTNAG 1 cut(s) 22
Hsp92II CATG 6 cut(s) 121, 145, 212, 334, 356, 391
HspAI GCGC 1 cut(s) 334
Kzo9I GATC 2 cut(s) 172, 211
LpnPI CCDG 3 cut(s) 66, 298, 318
Lsp1109I GCAGC 2 cut(s) 124, 376
LweI GCATC 1 cut(s) 404
MaeI CTAG 1 cut(s) 222
MaeIII GTNAC 1 cut(s) 326
MalI GATC 2 cut(s) 174, 213
MboI GATC 2 cut(s) 172, 211
MboII GAAGA 3 cut(s) 308, 368, 416
MluCI AATT 1 cut(s) 321
MnlI CCTC 1 cut(s) 77
Mph1103I ATGCAT 1 cut(s) 397
MseI TTAA 2 cut(s) 248, 315
Mva1269I GAATGC 1 cut(s) 397
MwoI GCNNNNNNNGC 2 cut(s) 23, 118
NdeI CATATG 1 cut(s) 237
NdeII GATC 2 cut(s) 172, 211
NlaIII CATG 6 cut(s) 121, 145, 212, 334, 356, 391
NsiI ATGCAT 1 cut(s) 397
NspI RCATGY 1 cut(s) 334
PagI TCATGA 2 cut(s) 141, 352
PctI GAATGC 1 cut(s) 397
PfeI GAWTC 3 cut(s) 62, 308, 413
PkrI GCNGC 2 cut(s) 114, 366
PsiI TTATAA 1 cut(s) 438
RsaI GTAC 1 cut(s) 289
RsaNI GTAC 1 cut(s) 288
SaqAI TTAA 2 cut(s) 248, 315
SatI GCNGC 2 cut(s) 113, 365
Sau3AI GATC 2 cut(s) 172, 211
ScaI AGTACT 1 cut(s) 289
SetI ASST 2 cut(s) 28, 223
SfaNI GCATC 1 cut(s) 404
SfcI CTRYAG 1 cut(s) 57
Sse9I AATT 1 cut(s) 321
SspMI CTAG 1 cut(s) 222
TasI AATT 1 cut(s) 321
TatI WGTACW 1 cut(s) 287
TfiI GAWTC 3 cut(s) 62, 308, 413
Tru1I TTAA 2 cut(s) 248, 315
Tru9I TTAA 2 cut(s) 248, 315
TseI GCWGC 2 cut(s) 112, 364
TspDTI ATGAA 6 cut(s) 17, 158, 224, 369, 404, 417
XceI RCATGY 1 cut(s) 334
XcmI CCANNNNNNNNNTGG 1 cut(s) 129
XspI CTAG 1 cut(s) 222
ZrmI AGTACT 1 cut(s) 289
Zsp2I ATGCAT 1 cut(s) 397
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.